Mutagenetix > Incidental Mutations

Incidental Mutation 'R6602:Adgrf5'

525390

Institutional Source

Beutler Lab

Gene Symbol

Adgrf5

Ensembl Gene

ENSMUSG00000056492

Gene Name

adhesion G protein-coupled receptor F5

Synonyms

Gpr116, 8430401C09Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6602 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43360451-43459557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43450304 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 963 (N963K)

Ref Sequence

ENSEMBL: ENSMUSP00000153049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225962] [ENSMUST00000226087]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082648

Predicted Effect

probably benign
Transcript: ENSMUST00000113599
AA Change: N963K

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: N963K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:EGF	118	161	8e-14	BLAST
Pfam:SEA	165	263	9.2e-14	PFAM
IG	276	366	1.54e-4	SMART
Blast:IG_like	374	464	2e-31	BLAST
IG	475	561	1.04e-1	SMART
low complexity region	815	823	N/A	INTRINSIC
GPS	949	1004	6.49e-16	SMART
Pfam:7tm_2	1011	1264	1.2e-35	PFAM
low complexity region	1328	1347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225962
AA Change: N758K

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000226087
AA Change: N963K

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	A	G	8: 124,639,254	L250P	probably damaging	Het
4921539E11Rik	T	C	4: 103,255,572	H12R	probably benign	Het
Abca4	A	C	3: 122,138,501	Q268P	probably benign	Het
Arl10	A	G	13: 54,578,937	D176G	probably damaging	Het
Btnl1	T	A	17: 34,385,748	M501K	probably damaging	Het
Ccdc162	G	T	10: 41,615,980	T1079K	probably benign	Het
Cd163	T	A	6: 124,311,635	W342R	probably damaging	Het
Cd70	T	C	17: 57,149,562	S14G	probably benign	Het
Chil4	C	A	3: 106,210,590	K121N	probably benign	Het
Csf1r	A	G	18: 61,110,425	D171G	possibly damaging	Het
Cyp4a31	A	T	4: 115,569,707		probably null	Het
D3Ertd254e	G	T	3: 36,164,855	L341F	possibly damaging	Het
Dapk1	A	T	13: 60,749,204	I746F	probably benign	Het
Erbb4	A	G	1: 68,370,503	S192P	probably damaging	Het
Exoc8	C	A	8: 124,896,411	V406L	probably damaging	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Greb1	A	T	12: 16,709,440	V652E	probably benign	Het
Ift88	A	G	14: 57,507,259	S745G	probably benign	Het
Il18bp	T	C	7: 102,016,030		probably benign	Het
Il6st	A	G	13: 112,504,413	T908A	probably damaging	Het
Klk11	A	G	7: 43,774,774	S6G	probably benign	Het
Mastl	T	C	2: 23,132,677	Y678C	probably benign	Het
Msra	A	T	14: 64,123,339	H184Q	probably benign	Het
Muc16	A	C	9: 18,609,476		probably null	Het
Myo3a	T	G	2: 22,577,787	L351R	probably damaging	Het
Npy5r	GCTGTGAAACACTG	GCTG	8: 66,681,540		probably null	Het
Olfr463	T	C	11: 87,893,652	T91A	probably benign	Het
Olfr830	A	G	9: 18,875,849	D174G	possibly damaging	Het
Olfr867	C	T	9: 20,055,046	R139Q	probably benign	Het
Pcdhb18	A	T	18: 37,490,480	I288F	probably damaging	Het
Pitpna	T	G	11: 75,620,315	V238G	possibly damaging	Het
Ppfibp1	T	A	6: 146,978,221	V81E	possibly damaging	Het
Rab11fip2	T	A	19: 59,942,856	T49S	probably damaging	Het
Rsl24d1	T	A	9: 73,113,510	I3N	possibly damaging	Het
Rtn1	T	C	12: 72,219,318	N161S	probably damaging	Het
Shank1	A	G	7: 44,352,336	I1151V	probably benign	Het
Slc34a3	A	G	2: 25,229,209	S550P	probably damaging	Het
Slc4a1ap	A	G	5: 31,527,641	H207R	probably damaging	Het
Sphkap	T	A	1: 83,275,758	K1423N	possibly damaging	Het
Ttn	A	G	2: 76,881,753		probably benign	Het
Ubqln5	T	A	7: 104,129,489	S43C	probably benign	Het
Vps13d	G	A	4: 145,103,664		probably benign	Het
Wwp1	A	T	4: 19,641,816	V413D	probably damaging	Het

Other mutations in Adgrf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Adgrf5	APN	17	43449915	missense	possibly damaging	0.79
IGL00590:Adgrf5	APN	17	43453147	missense	probably damaging	1.00
IGL01128:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01131:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01132:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01392:Adgrf5	APN	17	43450012	missense	probably benign	0.00
IGL01475:Adgrf5	APN	17	43450354	missense	probably benign	0.00
IGL01614:Adgrf5	APN	17	43424471	missense	possibly damaging	0.53
IGL01654:Adgrf5	APN	17	43451170	missense	possibly damaging	0.89
IGL02053:Adgrf5	APN	17	43450167	missense	possibly damaging	0.47
IGL02175:Adgrf5	APN	17	43451010	missense	probably damaging	1.00
IGL02416:Adgrf5	APN	17	43444980	splice site	probably null
IGL02525:Adgrf5	APN	17	43449963	missense	probably damaging	1.00
IGL03035:Adgrf5	APN	17	43430627	missense	possibly damaging	0.80
duct_tape	UTSW	17	43445115	missense	probably benign	0.04
Flypaper	UTSW	17	43422661	splice site	probably benign
la_brea	UTSW	17	43452323	critical splice donor site	probably null
Motel	UTSW	17	43450380	missense	probably damaging	1.00
Schmutzfinger	UTSW	17	43424818	nonsense	probably null
sticky	UTSW	17	43437571	missense	probably damaging	0.98
sweetie	UTSW	17	43450983	missense	probably damaging	0.96
PIT4812001:Adgrf5	UTSW	17	43450369	missense	probably damaging	1.00
R0699:Adgrf5	UTSW	17	43422661	splice site	probably null
R0972:Adgrf5	UTSW	17	43450983	missense	probably damaging	0.96
R1521:Adgrf5	UTSW	17	43430552	missense	probably benign	0.03
R1523:Adgrf5	UTSW	17	43450153	missense	probably benign	0.00
R1758:Adgrf5	UTSW	17	43424593	critical splice donor site	probably null
R1767:Adgrf5	UTSW	17	43450564	missense	possibly damaging	0.87
R1799:Adgrf5	UTSW	17	43440067	missense	probably damaging	0.98
R1800:Adgrf5	UTSW	17	43451082	missense	probably damaging	1.00
R1888:Adgrf5	UTSW	17	43427005	unclassified	probably null
R1888:Adgrf5	UTSW	17	43427005	unclassified	probably null
R2057:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2058:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2059:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2410:Adgrf5	UTSW	17	43455266	missense	probably benign	0.11
R2568:Adgrf5	UTSW	17	43437671	missense	probably damaging	1.00
R2847:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R2848:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R3800:Adgrf5	UTSW	17	43447060	splice site	probably benign
R3856:Adgrf5	UTSW	17	43447036	missense	possibly damaging	0.93
R4021:Adgrf5	UTSW	17	43430714	splice site	probably benign
R4075:Adgrf5	UTSW	17	43450195	missense	probably damaging	1.00
R4366:Adgrf5	UTSW	17	43441969	missense	probably damaging	0.99
R4409:Adgrf5	UTSW	17	43441847	missense	probably damaging	1.00
R4570:Adgrf5	UTSW	17	43445115	missense	probably benign	0.04
R4616:Adgrf5	UTSW	17	43452440	missense	probably benign	0.38
R4623:Adgrf5	UTSW	17	43450983	missense	probably benign	0.16
R4645:Adgrf5	UTSW	17	43437525	missense	probably damaging	1.00
R5211:Adgrf5	UTSW	17	43422620	missense	probably benign	0.32
R5268:Adgrf5	UTSW	17	43450999	missense	probably damaging	1.00
R5280:Adgrf5	UTSW	17	43426334	missense	probably damaging	1.00
R5326:Adgrf5	UTSW	17	43440074	missense	probably damaging	0.98
R5762:Adgrf5	UTSW	17	43430695	missense	probably null	0.16
R5856:Adgrf5	UTSW	17	43446120	missense	probably benign	0.09
R6007:Adgrf5	UTSW	17	43437571	missense	probably damaging	0.98
R6153:Adgrf5	UTSW	17	43451083	missense	possibly damaging	0.96
R6451:Adgrf5	UTSW	17	43424818	nonsense	probably null
R6535:Adgrf5	UTSW	17	43440029	missense	probably benign	0.05
R6536:Adgrf5	UTSW	17	43422661	splice site	probably benign
R6882:Adgrf5	UTSW	17	43450380	missense	probably damaging	1.00
R6992:Adgrf5	UTSW	17	43452323	critical splice donor site	probably null
R7137:Adgrf5	UTSW	17	43450897	missense	probably damaging	1.00
R7170:Adgrf5	UTSW	17	43446138	missense	possibly damaging	0.92
R7313:Adgrf5	UTSW	17	43445083	missense	probably benign	0.01
R7313:Adgrf5	UTSW	17	43452477	critical splice donor site	probably null
R7331:Adgrf5	UTSW	17	43437593	missense	probably damaging	0.99
R7346:Adgrf5	UTSW	17	43451179	missense	probably damaging	1.00
R7350:Adgrf5	UTSW	17	43428444	critical splice acceptor site	probably null
R7667:Adgrf5	UTSW	17	43446039	missense	probably benign	0.01
R7717:Adgrf5	UTSW	17	43450753	missense	probably damaging	1.00
R7731:Adgrf5	UTSW	17	43450560	missense	probably damaging	1.00
R7877:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
R7960:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
X0017:Adgrf5	UTSW	17	43427045	missense	probably damaging	1.00
Z1177:Adgrf5	UTSW	17	43445053	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAAAGCCATCCTTGCCCAG -3'
(R):5'- GCTTCCACAACTAGACAGGC -3'

Sequencing Primer
(F):5'- CTTGCCCAGGATGTACAGAG -3'
(R):5'- GCTAAGCTGACTATGGAAAACC -3'

Posted On

2018-06-22