Incidental Mutation 'R6720:1700013G24Rik'
ID 529532
Institutional Source Beutler Lab
Gene Symbol 1700013G24Rik
Ensembl Gene ENSMUSG00000041399
Gene Name RIKEN cDNA 1700013G24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137453284-137455461 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 137454686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 51 (E51K)
Ref Sequence ENSEMBL: ENSMUSP00000043461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048893]
AlphaFold Q9DAC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000048893
AA Change: E51K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043461
Gene: ENSMUSG00000041399
AA Change: E51K

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 181 203 N/A INTRINSIC
SCOP:d1i50b_ 216 261 3e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in 1700013G24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:1700013G24Rik APN 4 137455262 missense possibly damaging 0.82
IGL02646:1700013G24Rik APN 4 137454790 nonsense probably null
R0526:1700013G24Rik UTSW 4 137455224 missense possibly damaging 0.92
R1449:1700013G24Rik UTSW 4 137455355 missense possibly damaging 0.94
R3743:1700013G24Rik UTSW 4 137455037 missense probably damaging 0.96
R5357:1700013G24Rik UTSW 4 137455152 missense possibly damaging 0.90
R6265:1700013G24Rik UTSW 4 137454675 missense probably damaging 1.00
R6586:1700013G24Rik UTSW 4 137455328 missense possibly damaging 0.90
R6988:1700013G24Rik UTSW 4 137454579 missense probably damaging 1.00
R7640:1700013G24Rik UTSW 4 137454594 missense probably damaging 0.99
R7825:1700013G24Rik UTSW 4 137455343 missense probably damaging 1.00
R8905:1700013G24Rik UTSW 4 137455242 missense probably benign
Z1176:1700013G24Rik UTSW 4 137454992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGACCCGGCCAGAAAG -3'
(R):5'- AATGCCTTTGATGAGCTGGTCTAG -3'

Sequencing Primer
(F):5'- TTGACCCGGCCAGAAAGATGTC -3'
(R):5'- CTGTGCAGATCAGGCAGTG -3'
Posted On 2018-08-01