Incidental Mutation 'R6720:Ddx60'
ID529540
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62000689 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1281 (K1281E)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: K1280E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: K1280E

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: K1281E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: K1281E

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Meta Mutation Damage Score 0.1410 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTGAGGTGCAACTGGGTTG -3'
(R):5'- TCCCCAATTAAATGTCAAAGGGC -3'

Sequencing Primer
(F):5'- CAACTGGGTTGGTCTATGTCAAG -3'
(R):5'- GGGCATATGCAAAACTGTCAC -3'
Posted On2018-08-01