Incidental Mutation 'R6720:Cd6'
ID529565
Institutional Source Beutler Lab
Gene Symbol Cd6
Ensembl Gene ENSMUSG00000024670
Gene NameCD6 antigen
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10789341-10830058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10794609 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 414 (T414S)
Ref Sequence ENSEMBL: ENSMUSP00000079172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039043] [ENSMUST00000080292] [ENSMUST00000174176]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000025572
Predicted Effect probably benign
Transcript: ENSMUST00000039043
AA Change: T414S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046861
Gene: ENSMUSG00000024670
AA Change: T414S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 611 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080292
AA Change: T414S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079172
Gene: ENSMUSG00000024670
AA Change: T414S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173613
Predicted Effect probably benign
Transcript: ENSMUST00000174176
AA Change: T313S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134639
Gene: ENSMUSG00000024670
AA Change: T313S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
low complexity region 282 293 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein found on the outer membrane of T-lymphocytes as well as some other immune cells. The encoded protein contains three scavenger receptor cysteine-rich (SRCR) domains and a binding site for an activated leukocyte cell adhesion molecule. The gene product is important for continuation of T cell activation. This gene may be associated with susceptibility to multiple sclerosis (PMID: 19525953, 21849685). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to insteinal ischemia/reperfusion induced injury due to reduced IgM-producing B1a cell self-renewal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Cd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Cd6 APN 19 10796394 splice site probably benign
IGL01326:Cd6 APN 19 10791102 missense probably benign 0.09
IGL01406:Cd6 APN 19 10791137 missense possibly damaging 0.77
IGL01885:Cd6 APN 19 10799237 missense probably benign
IGL02268:Cd6 APN 19 10796388 missense probably benign 0.03
IGL03100:Cd6 APN 19 10792939 missense probably benign 0.34
R1856:Cd6 UTSW 19 10798602 missense probably damaging 0.98
R2419:Cd6 UTSW 19 10792852 missense probably damaging 1.00
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2874:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2936:Cd6 UTSW 19 10796322 splice site probably null
R4124:Cd6 UTSW 19 10790608 missense probably damaging 1.00
R4748:Cd6 UTSW 19 10794225 nonsense probably null
R6665:Cd6 UTSW 19 10791003 missense probably benign 0.03
R7793:Cd6 UTSW 19 10798358 nonsense probably null
Z1177:Cd6 UTSW 19 10791445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGCATGCTGGGAAAATC -3'
(R):5'- GGATCAGTTCATGGGTAGAAAGTC -3'

Sequencing Primer
(F):5'- TCCCACCATCAAGAGGTTTGG -3'
(R):5'- TTCATGGGTAGAAAGTCAAGGAAAG -3'
Posted On2018-08-01