Incidental Mutation 'R6720:Cox15'
ID529566
Institutional Source Beutler Lab
Gene Symbol Cox15
Ensembl Gene ENSMUSG00000040018
Gene Namecytochrome c oxidase assembly protein 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6720 (G1)
Quality Score125.008
Status Validated
Chromosome19
Chromosomal Location43733254-43753000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43736789 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 392 (S392P)
Ref Sequence ENSEMBL: ENSMUSP00000041820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045562] [ENSMUST00000081079]
Predicted Effect probably damaging
Transcript: ENSMUST00000045562
AA Change: S392P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041820
Gene: ENSMUSG00000040018
AA Change: S392P

DomainStartEndE-ValueType
Pfam:COX15-CtaA 73 402 2.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081079
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129242
Meta Mutation Damage Score 0.7736 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Cox15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cox15 APN 19 43743665 nonsense probably null
R0122:Cox15 UTSW 19 43748790 missense possibly damaging 0.56
R1452:Cox15 UTSW 19 43746905 missense probably damaging 1.00
R1931:Cox15 UTSW 19 43746785 missense probably benign 0.01
R1932:Cox15 UTSW 19 43746785 missense probably benign 0.01
R6268:Cox15 UTSW 19 43739926 missense possibly damaging 0.88
R7141:Cox15 UTSW 19 43736747 missense probably benign 0.05
R7743:Cox15 UTSW 19 43739941 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAATGACTTGACCAATTTGGAAACC -3'
(R):5'- ACTGACTGCGTCCTGGATTTC -3'

Sequencing Primer
(F):5'- CCAATTTGGAAACCATGTGGC -3'
(R):5'- ATTTTATGGATGCTTGCTTCTGAC -3'
Posted On2018-08-01