Mutagenetix > Incidental Mutation

Incidental Mutation 'R6816:Magi3'

540708

Institutional Source

Beutler Lab

Gene Symbol

Magi3

Ensembl Gene

ENSMUSG00000052539

Gene Name

membrane associated guanylate kinase, WW and PDZ domain containing 3

Synonyms

4732496O19Rik, 6530407C02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.502) question?

Stock #

R6816 (G1)

Quality Score

120.008

Status

Validated

Chromosome

Chromosomal Location

104013259-104220374 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 104089911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000064371

SMART Domains

Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
PDZ	27	108	1.94e-1	SMART
GuKc	114	281	8.56e-10	SMART
WW	297	329	9.14e-12	SMART
WW	343	375	2.47e-8	SMART
PDZ	421	497	1.48e-17	SMART
PDZ	589	659	3.07e-10	SMART
low complexity region	664	674	N/A	INTRINSIC
low complexity region	683	698	N/A	INTRINSIC
PDZ	737	813	1.34e-15	SMART
PDZ	861	939	7.65e-20	SMART
PDZ	1030	1104	1.55e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000121198

SMART Domains

Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
PDZ	27	108	1.94e-1	SMART
GuKc	114	281	8.56e-10	SMART
WW	297	329	9.14e-12	SMART
WW	343	375	2.47e-8	SMART
PDZ	421	497	1.48e-17	SMART
PDZ	589	659	3.07e-10	SMART
low complexity region	664	674	N/A	INTRINSIC
low complexity region	683	698	N/A	INTRINSIC
PDZ	737	813	1.34e-15	SMART
PDZ	861	939	7.65e-20	SMART
PDZ	1030	1104	1.55e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000122303

SMART Domains

Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
PDZ	27	108	1.94e-1	SMART
GuKc	114	281	8.56e-10	SMART
WW	297	329	9.14e-12	SMART
WW	343	375	2.47e-8	SMART
PDZ	421	497	1.48e-17	SMART
PDZ	589	659	3.07e-10	SMART
low complexity region	664	674	N/A	INTRINSIC
low complexity region	683	698	N/A	INTRINSIC
PDZ	737	813	1.34e-15	SMART
PDZ	861	939	7.65e-20	SMART
PDZ	1030	1104	1.55e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

96% (49/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg5	A	G	8: 94,941,683	T458A	probably damaging	Het
Ankrd36	T	G	11: 5,643,765	F457V	possibly damaging	Het
Cep152	T	C	2: 125,595,027	E531G	probably damaging	Het
Dpf1	A	C	7: 29,311,662	D162A	possibly damaging	Het
E2f8	A	T	7: 48,875,583	Y214N	possibly damaging	Het
Fer1l5	A	T	1: 36,406,510	Y786F	possibly damaging	Het
Fhod1	G	T	8: 105,330,544	Q933K	probably benign	Het
Gdap2	T	C	3: 100,191,705		probably null	Het
Gm6205	A	T	5: 94,683,914	Q260L	possibly damaging	Het
Gm996	C	CTCTA	2: 25,579,721		probably null	Het
Grin2d	A	G	7: 45,833,682		probably benign	Het
Hgs	T	A	11: 120,471,571	V112D	probably damaging	Het
Hist1h2bp	C	T	13: 21,787,777	S88L	probably benign	Het
Igf2r	A	T	17: 12,714,082	V851E	probably damaging	Het
Igfn1	T	A	1: 135,959,728	T2533S	probably benign	Het
Iqch	C	T	9: 63,480,759	V750I	probably benign	Het
Itih2	A	G	2: 10,105,706	Y525H	probably damaging	Het
Kcnu1	C	T	8: 25,937,734	Q360*	probably null	Het
Klk1b26	A	G	7: 44,016,868	N245S	probably benign	Het
Kmt2c	T	C	5: 25,405,532		probably null	Het
Lhpp	T	C	7: 132,634,033	S116P	probably benign	Het
Madcam1	A	G	10: 79,665,440	D113G	probably damaging	Het
Map3k9	A	G	12: 81,722,254	S1007P	possibly damaging	Het
Mkrn2	C	T	6: 115,611,728	P144L	probably damaging	Het
Mon1a	T	C	9: 107,900,410	S171P	probably damaging	Het
Nrarp	T	C	2: 25,181,307	L66P	probably damaging	Het
P2ry1	T	A	3: 61,003,832	F131I	probably benign	Het
Pdzk1	A	G	3: 96,854,570	Q166R	probably benign	Het
Pigt	G	T	2: 164,501,132	V249F	probably damaging	Het
Ppp1r16b	G	T	2: 158,761,675	V407L	probably benign	Het
Rab6a	G	T	7: 100,629,873	E73D	probably damaging	Het
Ralb	C	A	1: 119,477,982	G33*	probably null	Het
Sema3b	T	A	9: 107,600,350	M491L	probably benign	Het
Sema3c	A	C	5: 17,670,465	D40A	probably benign	Het
Slc22a1	T	C	17: 12,652,483	N464D	possibly damaging	Het
Spire2	T	A	8: 123,359,413	S295T	probably benign	Het
Stat3	T	G	11: 100,911,267	Q32P	probably damaging	Het
Sulf2	T	C	2: 166,082,754	T471A	probably benign	Het
Sult2b1	A	G	7: 45,733,678	W227R	probably damaging	Het
Syt2	T	A	1: 134,745,800	I294N	probably damaging	Het
Taar8b	A	T	10: 24,092,181	F38L	probably benign	Het
Tbl2	T	A	5: 135,159,215		probably null	Het
Tex48	G	A	4: 63,611,955	S9L	probably damaging	Het
Tmprss2	A	T	16: 97,568,467	M369K	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Tspoap1	T	C	11: 87,765,665	V263A	probably benign	Het
Vmn2r74	T	A	7: 85,961,413	R24*	probably null	Het
Wdr35	G	A	12: 9,027,724		probably null	Het
Zfp202	A	G	9: 40,211,813	R624G	probably damaging	Het

Other mutations in Magi3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Magi3	APN	3	104014978	missense	probably damaging	1.00
IGL00933:Magi3	APN	3	104015847	missense	probably benign
IGL01151:Magi3	APN	3	104051374	missense	probably damaging	1.00
IGL01674:Magi3	APN	3	104105721	splice site	probably benign
IGL01790:Magi3	APN	3	104085244	missense	probably damaging	1.00
IGL01903:Magi3	APN	3	104051210	missense	possibly damaging	0.87
IGL01939:Magi3	APN	3	104054462	missense	probably damaging	0.99
IGL02142:Magi3	APN	3	104015903	missense	probably benign	0.32
IGL02183:Magi3	APN	3	104085347	missense	probably benign	0.01
IGL02887:Magi3	APN	3	104095157	missense	probably damaging	1.00
IGL03071:Magi3	APN	3	104015886	missense	possibly damaging	0.51
IGL03085:Magi3	APN	3	104015339	missense	possibly damaging	0.88
IGL03192:Magi3	APN	3	104043246	missense	probably damaging	1.00
IGL03204:Magi3	APN	3	104105835	missense	probably damaging	1.00
IGL03227:Magi3	APN	3	104051119	missense	probably benign
IGL03388:Magi3	APN	3	104015841	missense	probably benign	0.30
PIT4280001:Magi3	UTSW	3	104054352	missense	probably damaging	1.00
PIT4504001:Magi3	UTSW	3	104015526	missense	probably benign	0.05
R0092:Magi3	UTSW	3	104050964	nonsense	probably null
R0514:Magi3	UTSW	3	104015022	missense	probably damaging	1.00
R0569:Magi3	UTSW	3	104016042	missense	probably benign	0.43
R0608:Magi3	UTSW	3	104017557	missense	probably damaging	1.00
R0920:Magi3	UTSW	3	104034191	splice site	probably null
R1173:Magi3	UTSW	3	104061630	critical splice donor site	probably null
R1256:Magi3	UTSW	3	104027810	missense	probably benign	0.08
R1391:Magi3	UTSW	3	104015058	nonsense	probably null
R1559:Magi3	UTSW	3	104046853	splice site	probably benign
R1568:Magi3	UTSW	3	104089527	missense	probably benign	0.02
R1631:Magi3	UTSW	3	104051177	missense	probably benign	0.05
R1747:Magi3	UTSW	3	104034173	missense	possibly damaging	0.82
R1930:Magi3	UTSW	3	104089604	missense	probably damaging	1.00
R1964:Magi3	UTSW	3	104020402	missense	probably damaging	0.99
R2151:Magi3	UTSW	3	104046882	missense	probably damaging	1.00
R2151:Magi3	UTSW	3	104085238	missense	probably damaging	1.00
R2266:Magi3	UTSW	3	104021066	intron	probably benign
R2267:Magi3	UTSW	3	104021066	intron	probably benign
R2268:Magi3	UTSW	3	104021066	intron	probably benign
R2519:Magi3	UTSW	3	104015765	missense	probably benign	0.00
R3104:Magi3	UTSW	3	104051320	missense	probably damaging	0.99
R3105:Magi3	UTSW	3	104051320	missense	probably damaging	0.99
R3619:Magi3	UTSW	3	104054405	missense	probably damaging	1.00
R4158:Magi3	UTSW	3	104050961	missense	probably damaging	1.00
R4160:Magi3	UTSW	3	104050961	missense	probably damaging	1.00
R4284:Magi3	UTSW	3	104015868	nonsense	probably null
R4285:Magi3	UTSW	3	104015868	nonsense	probably null
R4397:Magi3	UTSW	3	104219714	missense	probably damaging	1.00
R4512:Magi3	UTSW	3	104089555	missense	probably damaging	0.99
R4676:Magi3	UTSW	3	104015825	missense	probably benign
R4758:Magi3	UTSW	3	104015321	missense	probably benign	0.01
R4940:Magi3	UTSW	3	104051392	missense	probably damaging	1.00
R5039:Magi3	UTSW	3	104105791	missense	probably damaging	1.00
R5160:Magi3	UTSW	3	104027908	missense	possibly damaging	0.46
R5422:Magi3	UTSW	3	104051368	missense	probably damaging	1.00
R5509:Magi3	UTSW	3	104015502	missense	probably benign	0.00
R5839:Magi3	UTSW	3	104219731	missense	probably damaging	1.00
R5924:Magi3	UTSW	3	104054538	splice site	probably null
R6018:Magi3	UTSW	3	104105812	missense	probably damaging	1.00
R6189:Magi3	UTSW	3	104050865	missense	probably damaging	1.00
R6235:Magi3	UTSW	3	104016068	missense	probably damaging	0.99
R6244:Magi3	UTSW	3	104015697	missense	probably benign	0.16
R6258:Magi3	UTSW	3	104089596	missense	probably damaging	1.00
R6358:Magi3	UTSW	3	104050952	missense	probably damaging	1.00
R6534:Magi3	UTSW	3	104085220	missense	possibly damaging	0.75
R6806:Magi3	UTSW	3	104046969	missense	possibly damaging	0.94
R6897:Magi3	UTSW	3	104089557	missense	probably damaging	1.00
R7011:Magi3	UTSW	3	104105754	missense	probably damaging	1.00
R7039:Magi3	UTSW	3	104051383	missense	probably damaging	1.00
R7196:Magi3	UTSW	3	104049168	missense	probably benign	0.01
R7237:Magi3	UTSW	3	104027911	missense	probably damaging	1.00
R7285:Magi3	UTSW	3	104034114	missense	probably benign	0.00
R7709:Magi3	UTSW	3	104034038	missense	probably damaging	1.00
R7724:Magi3	UTSW	3	104015927	missense	probably benign	0.04
R7797:Magi3	UTSW	3	104051302	missense	probably damaging	1.00
R7950:Magi3	UTSW	3	104016689	missense	probably damaging	1.00
R8140:Magi3	UTSW	3	104034086	missense	probably damaging	1.00
R8204:Magi3	UTSW	3	104051186	missense	probably benign
R8229:Magi3	UTSW	3	104015701	missense	possibly damaging	0.79
R8229:Magi3	UTSW	3	104015702	missense	probably benign	0.00
R8260:Magi3	UTSW	3	104015309	missense	probably benign	0.01
R8348:Magi3	UTSW	3	104051215	missense	probably damaging	1.00
R8368:Magi3	UTSW	3	104095063	critical splice donor site	probably null
R8543:Magi3	UTSW	3	104219668	missense	probably damaging	0.98
R8762:Magi3	UTSW	3	104050853	missense	probably damaging	1.00
R8826:Magi3	UTSW	3	104085346	missense	probably benign	0.00
R8847:Magi3	UTSW	3	104015018	missense	probably benign	0.09
R8892:Magi3	UTSW	3	104050825	missense	probably damaging	1.00
R8939:Magi3	UTSW	3	104089432	intron	probably benign
R9090:Magi3	UTSW	3	104015948	missense	possibly damaging	0.68
R9187:Magi3	UTSW	3	104015757	missense	possibly damaging	0.76
R9271:Magi3	UTSW	3	104015948	missense	possibly damaging	0.68
R9433:Magi3	UTSW	3	104015157	missense	probably benign	0.01
R9439:Magi3	UTSW	3	104015157	missense	probably benign	0.01
R9557:Magi3	UTSW	3	104015157	missense	probably benign	0.01
R9557:Magi3	UTSW	3	104017617	missense	probably damaging	1.00
R9697:Magi3	UTSW	3	104049142	critical splice donor site	probably null
R9796:Magi3	UTSW	3	104020975	missense	probably benign
X0026:Magi3	UTSW	3	104020420	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCTGTCACTGACTAAAAGGCC -3'
(R):5'- AACTATCGCTTGCTTTTCTGAG -3'

Sequencing Primer
(F):5'- GGCCAAACAAAGCATTCTGTATG -3'
(R):5'- ATCGCTTGCTTTTCTGAGTGTATAC -3'

Posted On

2018-11-16