Incidental Mutation 'R5160:Magi3'
ID396922
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R5160 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104027908 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 903 (H903L)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064371
AA Change: H903L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: H903L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121198
AA Change: H903L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: H903L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122303
AA Change: H903L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: H903L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 intron probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7011:Magi3 UTSW 3 104105754 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7196:Magi3 UTSW 3 104049168 missense probably benign 0.01
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACATACTCTGGGCTTGTACTG -3'
(R):5'- AAAAGTCTCTGTGTGGTCAGTG -3'

Sequencing Primer
(F):5'- GTGTCTGTTCACAGCAACAG -3'
(R):5'- GAGGGGTGGACAGGATAATTATAC -3'
Posted On2016-06-21