Incidental Mutation 'R6974:Rgsl1'
ID542320
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6974 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153799822 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 913 (D913N)
Ref Sequence ENSEMBL: ENSMUSP00000139340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000185164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124558
AA Change: D878N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: D878N

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141249
AA Change: D198N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641
AA Change: D198N

DomainStartEndE-ValueType
Blast:RGS 3 300 3e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably damaging
Transcript: ENSMUST00000185164
AA Change: D913N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: D913N

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,159,447 N67K probably benign Het
Amotl1 C A 9: 14,644,920 E37* probably null Het
Ap4b1 C A 3: 103,813,285 Y90* probably null Het
Apc A G 18: 34,298,427 E277G possibly damaging Het
Armc4 A T 18: 7,294,479 Y45N probably benign Het
Atl1 T A 12: 69,926,039 H44Q probably damaging Het
Atp6v0b G A 4: 117,885,667 T74M probably benign Het
Auts2 T C 5: 131,440,599 T627A probably benign Het
B4galnt4 T A 7: 141,067,536 I372N possibly damaging Het
B4galt2 A G 4: 117,873,951 S338P probably damaging Het
Cfap43 A C 19: 47,785,278 probably null Het
Col4a1 T C 8: 11,312,538 probably benign Het
Col7a1 A C 9: 108,969,426 I1741L possibly damaging Het
Coprs A T 8: 13,885,750 S90T probably benign Het
Csrnp3 T C 2: 65,949,064 V40A possibly damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Ephx1 C A 1: 180,999,722 probably null Het
Erich6 C A 3: 58,618,799 R594L probably benign Het
F2rl2 A T 13: 95,700,530 N28Y probably damaging Het
Fbxo38 A T 18: 62,506,669 N1041K possibly damaging Het
Fcgr2b C T 1: 170,963,408 probably null Het
Fsip2 T A 2: 82,978,717 N1793K probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcnt3 A G 9: 70,034,887 I133T probably damaging Het
Hoxa1 T A 6: 52,158,041 I61F probably damaging Het
Impact C T 18: 12,982,112 L102F probably damaging Het
Ist1 A T 8: 109,677,652 I196N probably damaging Het
Kcnv2 T A 19: 27,333,882 S550T probably benign Het
Krt2 A T 15: 101,817,879 S75T unknown Het
Krtap21-1 A G 16: 89,403,578 S59P unknown Het
Lef1 A T 3: 131,111,574 I35F probably damaging Het
Lpcat2 A C 8: 92,873,079 N225T probably damaging Het
Lztfl1 A T 9: 123,709,584 N142K probably benign Het
Mdh1b G A 1: 63,721,816 H88Y probably benign Het
Mettl26 A G 17: 25,876,684 D171G probably damaging Het
Mrps24 A T 11: 5,704,663 M97K probably benign Het
Ms4a14 A T 19: 11,302,135 C1020S probably benign Het
Mterf1a A T 5: 3,890,854 I338K probably benign Het
Olfr1181 T C 2: 88,423,812 Y71C possibly damaging Het
Olfr381 A G 11: 73,486,473 I117T probably benign Het
Olfr591 T A 7: 103,173,235 H134L probably damaging Het
Olfr834 T A 9: 18,988,393 I135N probably damaging Het
Paqr3 T A 5: 97,108,287 H76L probably damaging Het
Parp1 T A 1: 180,589,506 Y618* probably null Het
Pilrb2 C T 5: 137,871,787 probably benign Het
Pkm A G 9: 59,668,570 N90D probably damaging Het
Pla2g4c T G 7: 13,344,534 probably null Het
Plppr4 C T 3: 117,323,018 V339I probably damaging Het
Pnkp T A 7: 44,861,038 D304E probably damaging Het
Pnlip T C 19: 58,679,635 probably null Het
Polr2a A G 11: 69,747,200 C148R probably damaging Het
Ppp1r10 G A 17: 35,929,551 G578S probably benign Het
Ptges2 C T 2: 32,397,671 T137I possibly damaging Het
Ptpre T C 7: 135,669,148 V344A possibly damaging Het
Rag1 A G 2: 101,641,792 F1002L probably damaging Het
Rcn2 T A 9: 56,053,014 Y188* probably null Het
Rest A G 5: 77,268,199 S87G probably damaging Het
Scp2 A G 4: 108,071,278 M1T probably null Het
Slamf8 T A 1: 172,588,023 N83Y probably damaging Het
Slc26a11 T A 11: 119,358,018 F75Y possibly damaging Het
Slc26a5 A G 5: 21,840,572 S133P probably damaging Het
Sncb A T 13: 54,762,674 V83E probably damaging Het
Tmem243 A G 5: 9,101,348 T11A probably damaging Het
Trim38 A G 13: 23,789,519 N277D probably benign Het
Vmn1r189 C T 13: 22,102,458 G70S probably damaging Het
Vmn2r-ps117 A G 17: 18,838,233 R684G probably benign Het
Wdr59 T C 8: 111,460,788 N792D possibly damaging Het
Wnt5a A G 14: 28,522,570 D238G possibly damaging Het
Zbtb42 C A 12: 112,680,390 T333K probably damaging Het
Zfp119b A G 17: 55,938,564 S509P probably benign Het
Zfp365 T A 10: 67,909,764 K61N probably damaging Het
Zfp553 T C 7: 127,236,653 F460S probably damaging Het
Zfp788 C T 7: 41,649,877 Q594* probably null Het
Zfp984 T A 4: 147,761,250 M1L possibly damaging Het
Zmiz2 T A 11: 6,397,566 Y291* probably null Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- GTCAAGCCAACTTTTGCTAGGAG -3'
(R):5'- GCAGACTGTAATTCCTTGTTGTTTC -3'

Sequencing Primer
(F):5'- CAGAGATCAATGTCTGGTGACTCC -3'
(R):5'- CTCTGTTAGATTTCTCTACATCACCC -3'
Posted On2018-11-28