Incidental Mutation 'R7091:Abhd18'
ID550196
Institutional Source Beutler Lab
Gene Symbol Abhd18
Ensembl Gene ENSMUSG00000037818
Gene Nameabhydrolase domain containing 18
Synonyms3110057O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40846970-40938138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40916738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 111 (I111L)
Ref Sequence ENSEMBL: ENSMUSP00000103712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108077] [ENSMUST00000108078] [ENSMUST00000159774] [ENSMUST00000203214] [ENSMUST00000203472] [ENSMUST00000203650] [ENSMUST00000203892] [ENSMUST00000204496] [ENSMUST00000205065]
Predicted Effect probably damaging
Transcript: ENSMUST00000108077
AA Change: I111L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103712
Gene: ENSMUSG00000037818
AA Change: I111L

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108078
AA Change: I111L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103713
Gene: ENSMUSG00000037818
AA Change: I111L

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159774
AA Change: I111L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124430
Gene: ENSMUSG00000037818
AA Change: I111L

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 1.3e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203214
SMART Domains Protein: ENSMUSP00000144946
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 62 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203472
AA Change: I35L

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145313
Gene: ENSMUSG00000037818
AA Change: I35L

DomainStartEndE-ValueType
Pfam:DUF2048 1 75 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203650
AA Change: I35L

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145006
Gene: ENSMUSG00000037818
AA Change: I35L

DomainStartEndE-ValueType
Pfam:DUF2048 1 130 8.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203892
AA Change: I111L

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145150
Gene: ENSMUSG00000037818
AA Change: I111L

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204496
SMART Domains Protein: ENSMUSP00000145007
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 67 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205065
AA Change: I111L

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145095
Gene: ENSMUSG00000037818
AA Change: I111L

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Abhd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Abhd18 APN 3 40933642 missense probably benign 0.00
IGL01785:Abhd18 APN 3 40905904 missense probably damaging 1.00
IGL02318:Abhd18 APN 3 40930227 critical splice donor site probably null
IGL02447:Abhd18 APN 3 40933773 missense probably benign
IGL02823:Abhd18 APN 3 40933518 splice site probably benign
IGL03023:Abhd18 APN 3 40904984 missense probably damaging 0.98
F2404:Abhd18 UTSW 3 40933878 missense probably damaging 0.99
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0494:Abhd18 UTSW 3 40916688 missense probably damaging 1.00
R1994:Abhd18 UTSW 3 40934926 nonsense probably null
R2206:Abhd18 UTSW 3 40910573 missense probably benign 0.00
R2223:Abhd18 UTSW 3 40934861 splice site probably benign
R2698:Abhd18 UTSW 3 40930966 missense probably benign 0.03
R3406:Abhd18 UTSW 3 40904903 start codon destroyed probably null 1.00
R3747:Abhd18 UTSW 3 40933573 missense probably benign
R4899:Abhd18 UTSW 3 40905869 splice site probably null
R5259:Abhd18 UTSW 3 40916890 missense probably damaging 1.00
R5673:Abhd18 UTSW 3 40923451 missense probably damaging 1.00
R5713:Abhd18 UTSW 3 40934979 nonsense probably null
R5797:Abhd18 UTSW 3 40933551 missense probably benign 0.08
R5983:Abhd18 UTSW 3 40910544 missense probably damaging 1.00
R6333:Abhd18 UTSW 3 40933783 missense probably benign
R6980:Abhd18 UTSW 3 40933780 missense probably benign
R7085:Abhd18 UTSW 3 40916909 missense possibly damaging 0.90
R7096:Abhd18 UTSW 3 40933870 missense probably damaging 1.00
R7168:Abhd18 UTSW 3 40934936 missense probably damaging 1.00
R8027:Abhd18 UTSW 3 40933723 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATGTAAATCCTCTGCCCCATC -3'
(R):5'- ACGAGCCATGAGTGTTCTGC -3'

Sequencing Primer
(F):5'- CTGGGCATGATGATACACACCTG -3'
(R):5'- CGCCTCCAGTAATGCTATGGAAAG -3'
Posted On2019-05-15