Incidental Mutation 'R7091:Fsd1'
ID550239
Institutional Source Beutler Lab
Gene Symbol Fsd1
Ensembl Gene ENSMUSG00000011589
Gene Namefibronectin type 3 and SPRY domain-containing protein
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_183178.2; Ensembl: ENSMUST00000011733

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55986511-55996881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55993876 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 245 (R245H)
Ref Sequence ENSEMBL: ENSMUSP00000011733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably damaging
Transcript: ENSMUST00000011733
AA Change: R245H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589
AA Change: R245H

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Fsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Fsd1 APN 17 55993943 critical splice donor site probably null
IGL01023:Fsd1 APN 17 55988245 missense probably damaging 1.00
IGL01382:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01383:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01384:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01386:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01387:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01561:Fsd1 APN 17 55995363 missense probably benign
IGL02065:Fsd1 APN 17 55996499 missense probably damaging 1.00
IGL02172:Fsd1 APN 17 55990244 splice site probably benign
IGL02515:Fsd1 APN 17 55996303 missense probably null 1.00
IGL02674:Fsd1 APN 17 55996483 missense probably benign 0.04
IGL03135:Fsd1 APN 17 55990416 splice site probably null
IGL03380:Fsd1 APN 17 55995456 missense probably benign 0.00
emboldened UTSW 17 55990542 critical splice donor site probably null
1mM(1):Fsd1 UTSW 17 55988199 missense probably benign 0.26
R0201:Fsd1 UTSW 17 55990522 missense probably benign 0.00
R0521:Fsd1 UTSW 17 55991245 missense probably benign
R0718:Fsd1 UTSW 17 55996445 unclassified probably null
R1077:Fsd1 UTSW 17 55990542 critical splice donor site probably null
R1519:Fsd1 UTSW 17 55993870 missense probably benign 0.14
R1696:Fsd1 UTSW 17 55988257 critical splice donor site probably null
R1867:Fsd1 UTSW 17 55991254 missense probably benign 0.00
R2173:Fsd1 UTSW 17 55991223 missense possibly damaging 0.64
R3889:Fsd1 UTSW 17 55993893 missense probably benign 0.27
R3950:Fsd1 UTSW 17 55995517 critical splice donor site probably null
R4787:Fsd1 UTSW 17 55996257 missense possibly damaging 0.51
R4912:Fsd1 UTSW 17 55991241 missense possibly damaging 0.71
R4936:Fsd1 UTSW 17 55996452 missense possibly damaging 0.63
R5718:Fsd1 UTSW 17 55990542 critical splice donor site probably benign
R5749:Fsd1 UTSW 17 55995849 splice site probably null
R7077:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7078:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7092:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7137:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7173:Fsd1 UTSW 17 55996696 missense possibly damaging 0.47
R7174:Fsd1 UTSW 17 55991356 missense probably benign 0.01
R7474:Fsd1 UTSW 17 55988149 missense possibly damaging 0.93
R7727:Fsd1 UTSW 17 55988150 missense probably benign 0.00
X0022:Fsd1 UTSW 17 55995464 nonsense probably null
Z1088:Fsd1 UTSW 17 55991203 missense probably damaging 0.98
Z1177:Fsd1 UTSW 17 55996083 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAAGGCGAGACTTGGTGTC -3'
(R):5'- TAGCAGCTAGAGTGACCAGGTC -3'

Sequencing Primer
(F):5'- ACCTGCTGCTCTTACAGAGGAC -3'
(R):5'- GGTCACCCCGTTACAATCCTTAAG -3'
Posted On2019-05-15