Incidental Mutation 'R7103:Pilra'
ID550986
Institutional Source Beutler Lab
Gene Symbol Pilra
Ensembl Gene ENSMUSG00000046245
Gene Namepaired immunoglobin-like type 2 receptor alpha
SynonymsFDF03
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137821952-137836281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137831226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000050313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058897] [ENSMUST00000110980] [ENSMUST00000197586] [ENSMUST00000199028]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058897
AA Change: D192G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050313
Gene: ENSMUSG00000046245
AA Change: D192G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Blast:IG 45 155 3e-69 BLAST
low complexity region 156 176 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110980
AA Change: D189G

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106608
Gene: ENSMUSG00000046245
AA Change: D189G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 42 152 1e-68 BLAST
low complexity region 153 173 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197586
SMART Domains Protein: ENSMUSP00000142631
Gene: ENSMUSG00000046245

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Blast:IG 42 94 8e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199028
SMART Domains Protein: ENSMUSP00000142391
Gene: ENSMUSG00000046245

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased increased alanine transferase, blood urea nitrogen, lactate dehydrogenase, neutrophils and mortality and altered liver morphology (massive hemorrhage, disorganized hepatic cords and karyolysis of hepatocytes) following treatment with LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Pilra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pilra APN 5 137835541 missense probably damaging 1.00
IGL02331:Pilra APN 5 137835655 nonsense probably null
IGL02815:Pilra APN 5 137831305 missense probably benign 0.00
IGL03067:Pilra APN 5 137823581 missense probably damaging 0.99
R0032:Pilra UTSW 5 137831265 missense probably damaging 1.00
R0032:Pilra UTSW 5 137831265 missense probably damaging 1.00
R2851:Pilra UTSW 5 137836080 missense probably benign 0.03
R2852:Pilra UTSW 5 137836080 missense probably benign 0.03
R4250:Pilra UTSW 5 137823552 missense probably benign 0.27
R4359:Pilra UTSW 5 137831314 missense probably benign 0.00
R4655:Pilra UTSW 5 137835326 splice site probably null
R4684:Pilra UTSW 5 137835515 missense probably damaging 1.00
R4744:Pilra UTSW 5 137835507 splice site probably null
R5001:Pilra UTSW 5 137835515 missense probably damaging 1.00
R5072:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5073:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5074:Pilra UTSW 5 137835412 missense probably damaging 0.97
R5337:Pilra UTSW 5 137835770 intron probably benign
R5349:Pilra UTSW 5 137831226 missense probably damaging 0.98
R5479:Pilra UTSW 5 137836056 missense possibly damaging 0.48
R6233:Pilra UTSW 5 137823501 missense possibly damaging 0.66
R6542:Pilra UTSW 5 137821975 splice site probably null
R7714:Pilra UTSW 5 137835417 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAACAACTTTGGCGTAGATTGT -3'
(R):5'- TCCTCCCCGATTCAAGAAGAA -3'

Sequencing Primer
(F):5'- CGTAGATTGTTCGGTGGAAAC -3'
(R):5'- GCTGTCAGAAGCATGTGAACTAACTC -3'
Posted On2019-05-15