Incidental Mutation 'R7103:Spam1'
ID550988
Institutional Source Beutler Lab
Gene Symbol Spam1
Ensembl Gene ENSMUSG00000029682
Gene Namesperm adhesion molecule 1
SynonymsPh-20
MMRRC Submission
Accession Numbers

Genbank: NM_001079875.1, NM_009241.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24791188-24801048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24800584 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 441 (M441V)
Ref Sequence ENSEMBL: ENSMUSP00000031693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031693] [ENSMUST00000202331] [ENSMUST00000202569]
Predicted Effect probably benign
Transcript: ENSMUST00000031693
AA Change: M441V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031693
Gene: ENSMUSG00000029682
AA Change: M441V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202331
AA Change: M441V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143944
Gene: ENSMUSG00000029682
AA Change: M441V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202569
AA Change: M441V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143970
Gene: ENSMUSG00000029682
AA Change: M441V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Male homozygotes for a targeted null mutation are normally fertile, but in vitro their sperm are slower at clearing cells from the cumulus mass. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Spam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spam1 APN 6 24796723 nonsense probably null
IGL02152:Spam1 APN 6 24800803 utr 3 prime probably benign
IGL02377:Spam1 APN 6 24796697 missense probably damaging 1.00
IGL02666:Spam1 APN 6 24796124 missense possibly damaging 0.67
IGL02968:Spam1 APN 6 24796443 missense possibly damaging 0.84
IGL03004:Spam1 APN 6 24796914 missense probably damaging 1.00
IGL03136:Spam1 APN 6 24797011 splice site probably benign
I2288:Spam1 UTSW 6 24796478 missense probably benign 0.00
I2289:Spam1 UTSW 6 24796478 missense probably benign 0.00
R0279:Spam1 UTSW 6 24800419 missense probably benign
R0454:Spam1 UTSW 6 24797838 missense probably damaging 0.99
R0486:Spam1 UTSW 6 24796395 missense probably damaging 1.00
R0734:Spam1 UTSW 6 24796949 missense probably benign 0.17
R0811:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R0812:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R1294:Spam1 UTSW 6 24796907 missense probably benign 0.12
R1703:Spam1 UTSW 6 24796257 missense probably damaging 1.00
R2156:Spam1 UTSW 6 24796268 missense probably damaging 1.00
R2163:Spam1 UTSW 6 24796847 missense probably benign 0.33
R2762:Spam1 UTSW 6 24796643 missense possibly damaging 0.94
R2970:Spam1 UTSW 6 24796725 missense probably damaging 1.00
R4646:Spam1 UTSW 6 24800587 missense probably benign 0.01
R4664:Spam1 UTSW 6 24796662 missense probably benign 0.01
R4923:Spam1 UTSW 6 24796656 missense probably damaging 1.00
R5452:Spam1 UTSW 6 24800732 missense probably benign 0.00
R5589:Spam1 UTSW 6 24796110 missense probably benign 0.01
R5591:Spam1 UTSW 6 24800546 missense probably damaging 0.99
R5861:Spam1 UTSW 6 24796571 missense probably benign
R6481:Spam1 UTSW 6 24796930 missense probably benign 0.01
R6564:Spam1 UTSW 6 24796356 missense possibly damaging 0.90
R6754:Spam1 UTSW 6 24796316 missense probably damaging 0.97
R7462:Spam1 UTSW 6 24796908 missense probably damaging 0.99
R7559:Spam1 UTSW 6 24800453 missense probably damaging 1.00
R8127:Spam1 UTSW 6 24796971 missense possibly damaging 0.95
X0022:Spam1 UTSW 6 24797886 missense possibly damaging 0.52
Z1176:Spam1 UTSW 6 24800323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCCAAACACTTTGTAATGAG -3'
(R):5'- ACTGACTAGTGTCTTCCGTGG -3'

Sequencing Primer
(F):5'- CCAAACACTTTGTAATGAGAAAGGC -3'
(R):5'- CTGACTAGTGTCTTCCGTGGAAAAAC -3'
Posted On2019-05-15