Incidental Mutation 'R7103:Gm9573'
ID551021
Institutional Source Beutler Lab
Gene Symbol Gm9573
Ensembl Gene ENSMUSG00000090588
Gene Namepredicted gene 9573
SynonymsMuc21, epiglycanin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35617923-35626637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35621540 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 585 (A585S)
Ref Sequence ENSEMBL: ENSMUSP00000130987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164502] [ENSMUST00000174521]
Predicted Effect unknown
Transcript: ENSMUST00000164502
AA Change: A585S
SMART Domains Protein: ENSMUSP00000130987
Gene: ENSMUSG00000090588
AA Change: A585S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 76 144 N/A INTRINSIC
low complexity region 149 578 N/A INTRINSIC
low complexity region 580 653 N/A INTRINSIC
low complexity region 655 1179 N/A INTRINSIC
low complexity region 1183 1373 N/A INTRINSIC
low complexity region 1383 1436 N/A INTRINSIC
low complexity region 1438 1479 N/A INTRINSIC
Pfam:Epiglycanin_C 1518 1605 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174521
SMART Domains Protein: ENSMUSP00000134221
Gene: ENSMUSG00000090509

DomainStartEndE-ValueType
Pfam:SFTA2 80 117 9.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Gm9573
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Gm9573 UTSW 17 35622121 intron probably benign
R0334:Gm9573 UTSW 17 35622722 intron probably benign
R0946:Gm9573 UTSW 17 35618213 missense probably benign 0.32
R1117:Gm9573 UTSW 17 35620028 intron probably benign
R1345:Gm9573 UTSW 17 35621597 intron probably benign
R1697:Gm9573 UTSW 17 35620648 intron probably benign
R1750:Gm9573 UTSW 17 35621048 intron probably benign
R1756:Gm9573 UTSW 17 35619239 intron probably benign
R1946:Gm9573 UTSW 17 35622524 intron probably benign
R1978:Gm9573 UTSW 17 35622965 intron probably benign
R1991:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R1992:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R2063:Gm9573 UTSW 17 35621405 intron probably benign
R2356:Gm9573 UTSW 17 35621671 intron probably benign
R2866:Gm9573 UTSW 17 35619707 intron probably benign
R3826:Gm9573 UTSW 17 35621612 intron probably benign
R4020:Gm9573 UTSW 17 35620061 intron probably benign
R4474:Gm9573 UTSW 17 35620604 intron probably benign
R4677:Gm9573 UTSW 17 35619707 intron probably benign
R4786:Gm9573 UTSW 17 35619329 intron probably benign
R5071:Gm9573 UTSW 17 35620552 intron probably benign
R5173:Gm9573 UTSW 17 35620741 intron probably benign
R5283:Gm9573 UTSW 17 35621332 intron probably benign
R5446:Gm9573 UTSW 17 35622503 intron probably benign
R5542:Gm9573 UTSW 17 35622503 intron probably benign
R5716:Gm9573 UTSW 17 35620783 intron probably benign
R5913:Gm9573 UTSW 17 35623231 intron probably benign
R6011:Gm9573 UTSW 17 35622182 intron probably benign
R6198:Gm9573 UTSW 17 35620916 intron probably benign
R6394:Gm9573 UTSW 17 35620166 intron probably benign
R6786:Gm9573 UTSW 17 35623165 intron probably benign
R6940:Gm9573 UTSW 17 35623226 intron probably benign
R7082:Gm9573 UTSW 17 35621201 missense unknown
R7110:Gm9573 UTSW 17 35622618 intron probably benign
R7139:Gm9573 UTSW 17 35622633 intron probably benign
R7165:Gm9573 UTSW 17 35621978 missense unknown
R7200:Gm9573 UTSW 17 35622633 intron probably benign
R7204:Gm9573 UTSW 17 35621213 intron probably benign
R7289:Gm9573 UTSW 17 35618869 missense unknown
R7290:Gm9573 UTSW 17 35618869 missense unknown
R7295:Gm9573 UTSW 17 35618869 missense unknown
R7319:Gm9573 UTSW 17 35622043 intron probably benign
R7462:Gm9573 UTSW 17 35620676 missense unknown
R7529:Gm9573 UTSW 17 35619231 missense unknown
R7718:Gm9573 UTSW 17 35622836 missense unknown
R7762:Gm9573 UTSW 17 35622085 missense unknown
R7788:Gm9573 UTSW 17 35618906 missense unknown
R7798:Gm9573 UTSW 17 35621254 missense unknown
RF025:Gm9573 UTSW 17 35622879 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAGTGCTGGATTCAGTG -3'
(R):5'- AGCACTGCCTCAAGATCTAC -3'

Sequencing Primer
(F):5'- CTGGATTCAGTGGTGGTCAG -3'
(R):5'- CTACCACCACTGCATCTAGC -3'
Posted On2019-05-15