Incidental Mutation 'PIT4504001:Arid5a'
ID 555987
Institutional Source Beutler Lab
Gene Symbol Arid5a
Ensembl Gene ENSMUSG00000037447
Gene Name AT rich interactive domain 5A (MRF1-like)
Synonyms D430024K22Rik, Mrf1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # PIT4504001 (G1)
Quality Score 184.009
Status Not validated
Chromosome 1
Chromosomal Location 36307733-36324029 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36317625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 116 (I116T)
Ref Sequence ENSEMBL: ENSMUSP00000095385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097778] [ENSMUST00000115029] [ENSMUST00000115031] [ENSMUST00000115032] [ENSMUST00000116629] [ENSMUST00000126413] [ENSMUST00000137906] [ENSMUST00000142319]
AlphaFold Q3U108
Predicted Effect probably damaging
Transcript: ENSMUST00000097778
AA Change: I116T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095385
Gene: ENSMUSG00000037447
AA Change: I116T

DomainStartEndE-ValueType
ARID 76 167 4.69e-34 SMART
BRIGHT 80 172 8.63e-31 SMART
low complexity region 453 467 N/A INTRINSIC
low complexity region 512 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115029
SMART Domains Protein: ENSMUSP00000110681
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
Blast:ARID 1 85 6e-24 BLAST
low complexity region 265 279 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115031
AA Change: I181T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110683
Gene: ENSMUSG00000037447
AA Change: I181T

DomainStartEndE-ValueType
ARID 46 232 1.82e-31 SMART
Blast:ARID 281 338 6e-11 BLAST
low complexity region 518 532 N/A INTRINSIC
low complexity region 577 587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115032
AA Change: I87T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110684
Gene: ENSMUSG00000037447
AA Change: I87T

DomainStartEndE-ValueType
ARID 47 138 4.69e-34 SMART
BRIGHT 51 143 8.63e-31 SMART
low complexity region 424 438 N/A INTRINSIC
low complexity region 483 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116629
AA Change: S47P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136037
Gene: ENSMUSG00000037447
AA Change: S47P

DomainStartEndE-ValueType
Blast:ARID 22 55 8e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126413
AA Change: I86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115490
Gene: ENSMUSG00000037447
AA Change: I86T

DomainStartEndE-ValueType
ARID 46 137 4.69e-34 SMART
BRIGHT 50 142 8.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137906
SMART Domains Protein: ENSMUSP00000117810
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
SCOP:d1ig6a_ 41 98 7e-19 SMART
PDB:2OEH|A 42 98 2e-26 PDB
Blast:ARID 42 186 4e-50 BLAST
low complexity region 366 380 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142319
SMART Domains Protein: ENSMUSP00000119953
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
SCOP:d1kkxa_ 49 81 3e-9 SMART
Blast:ARID 56 121 2e-41 BLAST
PDB:2OEH|A 56 121 2e-9 PDB
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ARID protein family, including ARID5A, have diverse functions but all appear to play important roles in development, tissue-specific gene expression, and regulation of cell growth (Patsialou et al., 2005 [PubMed 15640446]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced serum interleukin-6 and tumor necrosis factor levels following LPS treatment, and decreased susceptibility to experimental autoimmune encephalomyelitis along with decreased T-helper 17 cell number and increased IFN-gamma producing T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Arid5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Arid5a APN 1 36319433 missense possibly damaging 0.54
IGL02000:Arid5a APN 1 36319497 missense probably damaging 1.00
IGL02322:Arid5a APN 1 36319416 missense probably benign 0.09
R0063:Arid5a UTSW 1 36318564 missense probably damaging 1.00
R0063:Arid5a UTSW 1 36318564 missense probably damaging 1.00
R1556:Arid5a UTSW 1 36320164 nonsense probably null
R1703:Arid5a UTSW 1 36319575 splice site probably null
R2424:Arid5a UTSW 1 36318501 missense probably damaging 1.00
R4583:Arid5a UTSW 1 36317664 critical splice donor site probably null
R5725:Arid5a UTSW 1 36319130 nonsense probably null
R6056:Arid5a UTSW 1 36319392 missense probably benign 0.01
R7023:Arid5a UTSW 1 36317550 unclassified probably benign
R7996:Arid5a UTSW 1 36317445 missense unknown
R8739:Arid5a UTSW 1 36319596 missense probably benign 0.02
R9072:Arid5a UTSW 1 36319545 missense probably benign 0.01
R9073:Arid5a UTSW 1 36319545 missense probably benign 0.01
R9398:Arid5a UTSW 1 36318992 missense probably benign 0.08
R9583:Arid5a UTSW 1 36317658 missense possibly damaging 0.82
R9679:Arid5a UTSW 1 36318567 missense possibly damaging 0.89
X0020:Arid5a UTSW 1 36319575 splice site probably null
Z1176:Arid5a UTSW 1 36319355 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTAAAGGTGACCCTGGATGC -3'
(R):5'- ACCTGCTTAGGGATGCAAAG -3'

Sequencing Primer
(F):5'- ATGCCGCCAGCCTGTAG -3'
(R):5'- GTGCACAGTCCCCCATC -3'
Posted On 2019-06-07