Incidental Mutation 'R7206:Loxhd1'
ID560666
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R7206 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77441817 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2052 (D2052G)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410]
Predicted Effect probably damaging
Transcript: ENSMUST00000096547
AA Change: D2052G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: D2052G

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123166
AA Change: D500G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818
AA Change: D500G

DomainStartEndE-ValueType
LH2 1 114 6.41e-3 SMART
LH2 128 247 6.76e-6 SMART
Pfam:PLAT 261 379 1.3e-8 PFAM
LH2 397 515 7.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123410
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 M392I probably benign Het
Acr T C 15: 89,574,171 S352P probably benign Het
Adam6a T C 12: 113,546,034 C676R probably damaging Het
Adgra3 T C 5: 50,006,896 D247G probably damaging Het
Agxt2 A T 15: 10,377,456 E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 T805A probably benign Het
Atp8b4 T C 2: 126,458,292 S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 V287G possibly damaging Het
Ccr6 A T 17: 8,256,949 M329L probably benign Het
Cflar G T 1: 58,740,991 M248I Het
Cib4 A T 5: 30,545,766 L5* probably null Het
Col27a1 A T 4: 63,235,346 Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah7a A T 1: 53,698,633 L47* probably null Het
Dnajb6 A C 5: 29,781,337 K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 I157F possibly damaging Het
Drd4 G A 7: 141,292,119 G28R probably damaging Het
Dupd1 A G 14: 21,677,034 V182A probably damaging Het
Dus3l A T 17: 56,767,807 I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 L95P probably damaging Het
Fabp7 C T 10: 57,784,991 probably benign Het
Fam135a T C 1: 24,030,273 N505S probably benign Het
Fam213a T A 14: 41,004,185 M12L probably benign Het
Fam216b C A 14: 78,085,127 D46Y probably damaging Het
Gata6 C T 18: 11,054,850 R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm13124 T A 4: 144,558,641 D142V probably damaging Het
Golgb1 A G 16: 36,913,749 I1160M probably benign Het
Hfe2 A T 3: 96,528,128 D234V probably damaging Het
Kiss1 A G 1: 133,327,325 K26E probably benign Het
Knl1 T A 2: 119,069,299 F494I probably benign Het
Ktn1 T C 14: 47,695,528 L713S probably damaging Het
Lpo A C 11: 87,807,423 L582R probably damaging Het
Map2k3 A G 11: 60,943,580 T125A Het
Matn3 T A 12: 8,961,170 N360K probably benign Het
Mlip A T 9: 77,164,862 V237E probably damaging Het
Mms22l T C 4: 24,591,146 V999A probably benign Het
Mn1 A G 5: 111,420,512 K783E possibly damaging Het
Myo1h A T 5: 114,319,775 K132* probably null Het
Nle1 A G 11: 82,904,931 V230A probably benign Het
Olfr1240 T C 2: 89,440,457 probably benign Het
Olfr1318 T G 2: 112,156,459 C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 I44F probably benign Het
Olfr356 T A 2: 36,937,772 Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 S69P probably damaging Het
Olfr860 C T 9: 19,846,560 D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 H7L possibly damaging Het
Pam A G 1: 97,896,032 S225P probably damaging Het
Pan2 C A 10: 128,314,545 Y719* probably null Het
Ppfia4 T C 1: 134,327,389 S243G probably benign Het
Ppig T G 2: 69,741,566 S210A unknown Het
Ppwd1 A T 13: 104,213,598 N426K probably damaging Het
Rnf10 T G 5: 115,244,121 D675A probably benign Het
Rrp12 A T 19: 41,878,039 L619H probably damaging Het
Rsph10b C T 5: 143,961,192 T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 M1K probably null Het
Scp2 G T 4: 108,074,441 D332E probably benign Het
Senp3 T C 11: 69,678,731 I314V probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc44a2 T C 9: 21,346,807 F451S probably damaging Het
Slfn1 A T 11: 83,122,011 M318L probably benign Het
Syne2 C T 12: 76,004,757 S4087L probably benign Het
Syt7 A G 19: 10,417,973 Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 H315L probably damaging Het
Tmem184c A G 8: 77,596,577 V552A possibly damaging Het
Tnxb A G 17: 34,704,101 R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 R173S probably benign Het
Tonsl T C 15: 76,633,651 D650G probably damaging Het
Tpo G C 12: 30,103,134 S407W possibly damaging Het
Trank1 T C 9: 111,345,515 probably null Het
Trp53tg5 T C 2: 164,471,458 E99G probably damaging Het
Tubb2a C A 13: 34,075,522 S95I possibly damaging Het
Vav2 C A 2: 27,336,719 R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 N88S probably benign Het
Vps13a T C 19: 16,754,298 N150S probably damaging Het
Vps35 A T 8: 85,287,721 Y100N probably damaging Het
Vps8 A C 16: 21,457,421 I235L probably damaging Het
Yipf2 T A 9: 21,590,361 H157L probably damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp503 G T 14: 21,985,485 S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 R285C probably benign Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 splice site probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 splice site probably null
R1465:Loxhd1 UTSW 18 77380573 splice site probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77385050 missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77375194 missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77431192 missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77340149 missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77342013 missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77404816 missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77380496 missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77388399 missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77381638 missense possibly damaging 0.77
R8246:Loxhd1 UTSW 18 77363546 missense possibly damaging 0.71
R8263:Loxhd1 UTSW 18 77375162 missense probably damaging 1.00
R8324:Loxhd1 UTSW 18 77339579 critical splice donor site probably null
R8342:Loxhd1 UTSW 18 77405985 missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77380460 missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77431131 missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77441466 missense possibly damaging 0.96
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGCGCAACCTCTTCG -3'
(R):5'- AAGGTAGAGGCCAGGATTCC -3'

Sequencing Primer
(F):5'- TCTTCGAGAGGGGCAGTAC -3'
(R):5'- ACTGTCACTTGCAAGGAGC -3'
Posted On2019-06-26