Incidental Mutation 'R7283:Slc6a4'
ID565812
Institutional Source Beutler Lab
Gene Symbol Slc6a4
Ensembl Gene ENSMUSG00000020838
Gene Namesolute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms5-HTT, Sert, Htt
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R7283 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76998603-77032340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77010696 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 86 (M86L)
Ref Sequence ENSEMBL: ENSMUSP00000021195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402] [ENSMUST00000129572]
Predicted Effect probably benign
Transcript: ENSMUST00000021195
AA Change: M86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: M86L

DomainStartEndE-ValueType
Pfam:5HT_transport_N 24 64 3e-27 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108402
AA Change: M86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: M86L

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 7.8e-30 PFAM
Pfam:SNF 79 600 7.3e-232 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129572
AA Change: M86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115264
Gene: ENSMUSG00000020838
AA Change: M86L

DomainStartEndE-ValueType
Pfam:5HT_transporter 23 64 1e-30 PFAM
Pfam:SNF 79 158 1.8e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,274,828 Q1346R probably damaging Het
4833439L19Rik A G 13: 54,552,691 V278A probably benign Het
4932415D10Rik G A 10: 82,291,297 R1960W possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abce1 C A 8: 79,685,256 G592* probably null Het
Acad10 A C 5: 121,649,475 V137G possibly damaging Het
Adcy3 A G 12: 4,203,563 I672V not run Het
Adgrb1 A T 15: 74,580,663 Q1166L possibly damaging Het
Ankrd44 A T 1: 54,729,796 N465K probably damaging Het
Avpr1b A G 1: 131,609,731 T418A probably benign Het
Azin1 G A 15: 38,501,408 T33I probably damaging Het
Bicra T C 7: 15,972,500 T1339A probably damaging Het
Cacna1s A G 1: 136,073,708 Y299C probably damaging Het
Clip1 A C 5: 123,613,794 C641W Het
Clip3 T C 7: 30,305,812 S524P probably damaging Het
Cnpy4 A T 5: 138,192,882 H240L probably benign Het
Cyp2b19 T C 7: 26,766,914 Y381H probably damaging Het
Cyp3a13 T A 5: 137,905,556 N280I probably benign Het
Diaph3 A G 14: 86,866,584 F788S probably damaging Het
Drc7 A G 8: 95,071,579 N484S probably damaging Het
Erap1 G A 13: 74,673,784 probably null Het
Fat4 A T 3: 38,889,693 I912F probably damaging Het
Hsd3b3 T A 3: 98,742,357 K217* probably null Het
Igkv12-89 A G 6: 68,835,077 V36A probably damaging Het
Invs T A 4: 48,392,526 probably null Het
Ipo8 T A 6: 148,824,481 Y30F possibly damaging Het
Kctd14 T C 7: 97,451,486 M1T probably null Het
Klrb1c A T 6: 128,784,257 C136S probably benign Het
Morn2 A G 17: 80,297,259 E48G probably damaging Het
Myh1 A T 11: 67,201,844 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,529,050 S603P probably benign Het
Nlrc3 G A 16: 3,947,877 A351V probably benign Het
Nlrp4f G A 13: 65,195,538 R76* probably null Het
Olfr190 A T 16: 59,074,192 M296K probably benign Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr397 T C 11: 73,964,808 S67P probably damaging Het
Olfr664 G T 7: 104,733,593 T257K probably damaging Het
Olfr872 A C 9: 20,260,259 I140L probably damaging Het
Papolg A G 11: 23,867,394 V601A not run Het
Pde4dip T C 3: 97,758,882 T349A probably benign Het
Pdlim5 T C 3: 142,311,980 probably null Het
Pkhd1l1 A G 15: 44,503,280 N718S probably benign Het
Plcxd3 A G 15: 4,516,919 H135R probably damaging Het
Plxna2 A T 1: 194,644,883 Y375F probably damaging Het
Prkca C T 11: 108,340,645 probably null Het
Prkdc A G 16: 15,717,764 S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 T80A probably benign Het
Ptpn4 C T 1: 119,682,531 V696I possibly damaging Het
Pygl A T 12: 70,216,568 W175R possibly damaging Het
Rftn1 A G 17: 50,047,441 Y298H probably damaging Het
Rit2 A G 18: 31,316,839 probably null Het
Runx1t1 G A 4: 13,846,935 G240R probably damaging Het
Scn10a A G 9: 119,664,779 probably null Het
Serpina16 A C 12: 103,672,432 probably null Het
Slc17a3 A T 13: 23,855,848 M290L Het
Spag7 A T 11: 70,665,313 V46E probably benign Het
Sptlc1 T C 13: 53,344,878 I271V probably benign Het
Stk17b A C 1: 53,757,515 H364Q probably benign Het
Strc T C 2: 121,379,452 H130R probably damaging Het
Stxbp1 T A 2: 32,815,014 D148V probably damaging Het
Tirap G A 9: 35,188,929 P153L probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem51 T A 4: 142,031,783 D218V probably damaging Het
Trim40 A T 17: 36,882,662 D218E probably benign Het
Ttc21b T C 2: 66,208,718 D934G probably damaging Het
Vmn2r26 T C 6: 124,025,955 L108P probably damaging Het
Washc2 C A 6: 116,227,418 P429Q probably damaging Het
Wipi1 A G 11: 109,611,311 M1T probably null Het
Zfp438 A G 18: 5,214,712 V82A probably damaging Het
Zfp853 G C 5: 143,287,738 A724G unknown Het
Other mutations in Slc6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slc6a4 APN 11 77023180 missense probably benign 0.00
IGL01403:Slc6a4 APN 11 77031672 missense probably benign 0.00
IGL01608:Slc6a4 APN 11 77027135 missense probably damaging 1.00
IGL01759:Slc6a4 APN 11 77013288 missense probably damaging 1.00
IGL02239:Slc6a4 APN 11 77027156 missense probably benign 0.01
IGL02491:Slc6a4 APN 11 77027208 missense probably damaging 1.00
IGL03221:Slc6a4 APN 11 77027105 missense probably benign
R1122:Slc6a4 UTSW 11 77027186 missense possibly damaging 0.90
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1574:Slc6a4 UTSW 11 77019196 missense possibly damaging 0.93
R1768:Slc6a4 UTSW 11 77013252 missense probably damaging 1.00
R1876:Slc6a4 UTSW 11 77015164 missense probably benign 0.34
R1884:Slc6a4 UTSW 11 77013375 missense probably benign 0.01
R4362:Slc6a4 UTSW 11 77017078 missense probably damaging 1.00
R4595:Slc6a4 UTSW 11 77019863 missense probably benign 0.16
R4855:Slc6a4 UTSW 11 77013309 missense probably damaging 1.00
R5569:Slc6a4 UTSW 11 77023255 missense possibly damaging 0.88
R5747:Slc6a4 UTSW 11 77010511 missense probably damaging 0.97
R5802:Slc6a4 UTSW 11 77019236 missense probably damaging 1.00
R6242:Slc6a4 UTSW 11 77018358 nonsense probably null
R6344:Slc6a4 UTSW 11 77018254 missense probably damaging 1.00
R6443:Slc6a4 UTSW 11 77023201 missense probably benign 0.05
R6935:Slc6a4 UTSW 11 77027168 missense probably benign 0.06
R7313:Slc6a4 UTSW 11 77010701 missense possibly damaging 0.75
R7347:Slc6a4 UTSW 11 77017085 nonsense probably null
R7535:Slc6a4 UTSW 11 77015150 missense possibly damaging 0.70
R7826:Slc6a4 UTSW 11 77013025 missense probably benign 0.27
R8055:Slc6a4 UTSW 11 77010598 missense probably benign 0.00
RF007:Slc6a4 UTSW 11 77019182 missense probably damaging 1.00
Z1177:Slc6a4 UTSW 11 77016683 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCAAGAAAATGGTGTTCTG -3'
(R):5'- TTAGGCTCACGTCAGCTACC -3'

Sequencing Primer
(F):5'- TTCTGCAGAAGGGTGTCCC -3'
(R):5'- GCTACCCAGGACAGTAAAGATTATG -3'
Posted On2019-06-26