Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:St7l'

567297

Institutional Source

Beutler Lab

Gene Symbol

St7l

Ensembl Gene

ENSMUSG00000045576

Gene Name

suppression of tumorigenicity 7-like

Synonyms

St7r

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104864005-104930064 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104889353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 261 (F261L)

Ref Sequence

ENSEMBL: ENSMUSP00000058455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059271] [ENSMUST00000106769] [ENSMUST00000123876] [ENSMUST00000183914] [ENSMUST00000200132]

AlphaFold

Q8K4P7

Predicted Effect

probably benign
Transcript: ENSMUST00000059271
AA Change: F261L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000058455
Gene: ENSMUSG00000045576
AA Change: F261L

Domain	Start	End	E-Value	Type
low complexity region	22	31	N/A	INTRINSIC
Pfam:ST7	41	559	1.6e-292	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106769
AA Change: F261L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102380
Gene: ENSMUSG00000045576
AA Change: F261L

Domain	Start	End	E-Value	Type
low complexity region	22	31	N/A	INTRINSIC
Pfam:ST7	41	420	8.2e-209	PFAM
Pfam:ST7	419	527	1.4e-57	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123876
AA Change: F254L

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138577
Gene: ENSMUSG00000045576
AA Change: F254L

Domain	Start	End	E-Value	Type
low complexity region	22	31	N/A	INTRINSIC
Pfam:ST7	41	282	6.7e-96	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183914

SMART Domains

Protein: ENSMUSP00000139266
Gene: ENSMUSG00000045576

Domain	Start	End	E-Value	Type
low complexity region	22	31	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000197098
AA Change: F129L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000199335

Predicted Effect

probably benign
Transcript: ENSMUST00000200132

SMART Domains

Protein: ENSMUSP00000143759
Gene: ENSMUSG00000045576

Domain	Start	End	E-Value	Type
low complexity region	22	31	N/A	INTRINSIC
Pfam:ST7	41	212	2.7e-81	PFAM
Pfam:ST7	209	481	1.3e-167	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the ST7 tumor suppressor gene found in the chromosome 7q31 region. This gene is clustered in a tail-to-tail manner with the WNT2B gene in a chromosomal region known to be deleted and rearranged in a variety of cancers. Several transcript variants encoding many different isoforms have been described, but some have not been fully characterized. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Gpr179	C	T	11: 97,338,846	E828K	probably benign	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in St7l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:St7l	APN	3	104873579	splice site	probably benign
IGL00919:St7l	APN	3	104926466	missense	probably damaging	1.00
IGL00945:St7l	APN	3	104926482	missense	probably damaging	0.96
IGL01644:St7l	APN	3	104919456	nonsense	probably null
IGL02158:St7l	APN	3	104874832	missense	possibly damaging	0.48
IGL02164:St7l	APN	3	104922281	critical splice donor site	probably null
IGL02331:St7l	APN	3	104926588	missense	probably damaging	0.98
IGL03220:St7l	APN	3	104874823	splice site	probably benign
R0118:St7l	UTSW	3	104889303	missense	probably damaging	0.97
R0320:St7l	UTSW	3	104870913	nonsense	probably null
R0345:St7l	UTSW	3	104895809	splice site	probably benign
R0714:St7l	UTSW	3	104874928	missense	probably benign	0.06
R0784:St7l	UTSW	3	104870924	missense	probably benign	0.13
R1664:St7l	UTSW	3	104870898	missense	probably damaging	1.00
R1719:St7l	UTSW	3	104870987	missense	probably benign	0.00
R1800:St7l	UTSW	3	104919496	missense	probably damaging	1.00
R1882:St7l	UTSW	3	104868047	missense	probably damaging	1.00
R3692:St7l	UTSW	3	104891554	missense	probably benign	0.27
R3879:St7l	UTSW	3	104926447	missense	probably damaging	1.00
R5130:St7l	UTSW	3	104895764	missense	probably damaging	1.00
R5271:St7l	UTSW	3	104868060	missense	probably damaging	1.00
R5887:St7l	UTSW	3	104874928	missense	probably benign	0.06
R6191:St7l	UTSW	3	104868033	missense	probably damaging	1.00
R6252:St7l	UTSW	3	104919503	critical splice donor site	probably null
R7442:St7l	UTSW	3	104889329	missense	possibly damaging	0.93
R7860:St7l	UTSW	3	104926577	missense	probably benign	0.05
R8523:St7l	UTSW	3	104868057	missense	probably damaging	1.00
R8934:St7l	UTSW	3	104889318	missense	probably damaging	1.00
R8935:St7l	UTSW	3	104870888	missense	probably damaging	1.00
Z1177:St7l	UTSW	3	104865309	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGGTGAGTTGACATACTGAGTG -3'
(R):5'- GGACCATCCTCACCTACATG -3'

Sequencing Primer
(F):5'- TCTCAAAGATGGAAAGTATAGGTAGG -3'
(R):5'- CCTACATGGCAAATCGGAGGTTAAC -3'

Posted On

2019-06-26