Incidental Mutation 'R7307:Kmt2b'
ID 567310
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Name lysine (K)-specific methyltransferase 2B
Synonyms 2610014H22Rik, Mll2, Wbp7
MMRRC Submission 045366-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7307 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30268283-30288151 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30279896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1368 (H1368R)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006470
AA Change: H1368R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: H1368R

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108154
AA Change: H1368R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: H1368R

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: H659R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik G A 16: 16,936,259 (GRCm39) P155L probably benign Het
Adamts12 G T 15: 11,217,899 (GRCm39) L285F probably damaging Het
Ankrd6 A T 4: 32,816,949 (GRCm39) Y393N possibly damaging Het
Arhgap45 A G 10: 79,865,016 (GRCm39) Q993R probably benign Het
Arhgef33 G C 17: 80,654,549 (GRCm39) probably null Het
B4galnt3 T C 6: 120,192,392 (GRCm39) D448G probably benign Het
Capn1 C G 19: 6,043,938 (GRCm39) E564D possibly damaging Het
Ccdc85a A G 11: 28,349,384 (GRCm39) S474P probably benign Het
Cdk12 T A 11: 98,140,626 (GRCm39) L1289* probably null Het
Cramp1 A T 17: 25,193,719 (GRCm39) N920K possibly damaging Het
Cubn C T 2: 13,345,143 (GRCm39) S2091N probably damaging Het
Ddx1 A T 12: 13,273,960 (GRCm39) I581N probably damaging Het
Dnm2 A T 9: 21,396,983 (GRCm39) N487Y probably damaging Het
Enc1 A C 13: 97,381,601 (GRCm39) N37T probably damaging Het
Ephb3 T G 16: 21,040,976 (GRCm39) I932S probably benign Het
Frk T A 10: 34,467,934 (GRCm39) M316K probably damaging Het
Gdap2 C T 3: 100,109,349 (GRCm39) R25C unknown Het
Gpat2 T A 2: 127,276,810 (GRCm39) D671E probably damaging Het
Gpr179 C T 11: 97,229,672 (GRCm39) E828K probably benign Het
Greb1l T C 18: 10,538,142 (GRCm39) Y1052H probably damaging Het
Gtf2f1 C T 17: 57,314,833 (GRCm39) S69N probably damaging Het
Hid1 A C 11: 115,239,308 (GRCm39) I785S probably damaging Het
Hmcn2 T C 2: 31,233,093 (GRCm39) I214T probably damaging Het
Hsd3b5 G T 3: 98,527,085 (GRCm39) F120L probably damaging Het
Kif16b C T 2: 142,554,851 (GRCm39) R649Q probably benign Het
Kif17 A T 4: 137,989,954 (GRCm39) E47D probably benign Het
Kmt2d A T 15: 98,747,299 (GRCm39) S3342T unknown Het
Krt82 A G 15: 101,451,342 (GRCm39) C356R probably damaging Het
Lrit2 A G 14: 36,794,156 (GRCm39) K407E probably benign Het
Malt1 T A 18: 65,584,640 (GRCm39) H325Q possibly damaging Het
Mccc2 T G 13: 100,125,108 (GRCm39) D187A possibly damaging Het
Mgll T A 6: 88,791,103 (GRCm39) probably null Het
Mindy2 T G 9: 70,518,241 (GRCm39) E449A possibly damaging Het
Muc5b G A 7: 141,396,031 (GRCm39) V96M unknown Het
Nlrp4e A G 7: 23,020,953 (GRCm39) E480G probably benign Het
Nup98 A G 7: 101,784,002 (GRCm39) I1093T probably benign Het
Or13a26 G A 7: 140,285,060 (GRCm39) V299I probably benign Het
Or1j4 G A 2: 36,740,137 (GRCm39) M26I probably benign Het
Or4g7 A T 2: 111,309,105 (GRCm39) probably benign Het
Or52a20 G T 7: 103,366,173 (GRCm39) R124L probably damaging Het
Pcdhb6 A T 18: 37,468,531 (GRCm39) H484L probably benign Het
Phldb1 T C 9: 44,605,344 (GRCm39) T604A possibly damaging Het
Pitpnm3 G T 11: 71,961,790 (GRCm39) A275D probably damaging Het
Polr2a A T 11: 69,638,118 (GRCm39) probably null Het
Polr3a A G 14: 24,510,055 (GRCm39) C960R probably benign Het
Pou6f2 G A 13: 18,414,298 (GRCm39) A159V Het
Pramel11 A C 4: 143,623,345 (GRCm39) Y276* probably null Het
Pramel51 A C 12: 88,148,519 (GRCm39) C32W probably damaging Het
Psmc4 A G 7: 27,742,085 (GRCm39) V303A probably benign Het
Ptdss2 A G 7: 140,731,645 (GRCm39) N151S possibly damaging Het
Ptprk T A 10: 28,465,004 (GRCm39) Y1295* probably null Het
Rbm19 A G 5: 120,324,283 (GRCm39) K881E possibly damaging Het
Rcan2 T A 17: 44,331,993 (GRCm39) Y183* probably null Het
Rnd1 T C 15: 98,568,680 (GRCm39) E166G probably damaging Het
Rnf113a2 T A 12: 84,464,953 (GRCm39) C282S probably damaging Het
S100b G A 10: 76,092,926 (GRCm39) G20R probably benign Het
Sae1 G T 7: 16,102,469 (GRCm39) Y168* probably null Het
Samd9l C A 6: 3,372,600 (GRCm39) G1554* probably null Het
Samhd1 T C 2: 156,976,940 (GRCm39) S55G probably benign Het
Sgsm1 T C 5: 113,421,512 (GRCm39) D525G probably benign Het
Slc28a3 A T 13: 58,710,986 (GRCm39) M512K probably damaging Het
Slc9b2 T A 3: 135,024,151 (GRCm39) N67K probably benign Het
Smarca4 T A 9: 21,550,096 (GRCm39) I402N probably damaging Het
St7l T C 3: 104,796,669 (GRCm39) F261L probably benign Het
Syde2 T A 3: 145,721,553 (GRCm39) V1140D probably damaging Het
Syt6 T A 3: 103,494,788 (GRCm39) I251N probably damaging Het
Taok2 T C 7: 126,465,990 (GRCm39) E916G probably damaging Het
Tecta A G 9: 42,289,288 (GRCm39) S426P probably damaging Het
Thra T C 11: 98,655,134 (GRCm39) I338T probably damaging Het
Trub1 A T 19: 57,461,135 (GRCm39) Y137F probably damaging Het
Vps13b T C 15: 35,841,691 (GRCm39) F2574L probably benign Het
Ythdf3 T C 3: 16,237,664 (GRCm39) S2P possibly damaging Het
Zc3h13 T A 14: 75,567,981 (GRCm39) D1091E probably damaging Het
Zdhhc6 A G 19: 55,301,682 (GRCm39) Y100H probably damaging Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30,285,938 (GRCm39) unclassified probably benign
IGL00821:Kmt2b APN 7 30,270,038 (GRCm39) missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30,279,352 (GRCm39) missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30,279,932 (GRCm39) missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30,268,939 (GRCm39) critical splice donor site probably null
IGL01949:Kmt2b APN 7 30,276,586 (GRCm39) splice site probably null
IGL02253:Kmt2b APN 7 30,281,152 (GRCm39) missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30,278,303 (GRCm39) critical splice donor site probably null
IGL02493:Kmt2b APN 7 30,268,936 (GRCm39) unclassified probably benign
IGL02504:Kmt2b APN 7 30,285,968 (GRCm39) unclassified probably benign
IGL02532:Kmt2b APN 7 30,286,314 (GRCm39) unclassified probably benign
IGL02698:Kmt2b APN 7 30,278,118 (GRCm39) splice site probably benign
IGL02717:Kmt2b APN 7 30,282,869 (GRCm39) missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30,276,569 (GRCm39) missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30,274,887 (GRCm39) missense probably benign 0.02
IGL03386:Kmt2b APN 7 30,273,396 (GRCm39) missense possibly damaging 0.94
Dean UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
provost UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
tenure UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
3-1:Kmt2b UTSW 7 30,269,040 (GRCm39) nonsense probably null
FR4304:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4342:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4548:Kmt2b UTSW 7 30,285,805 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,806 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
FR4589:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,795 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,792 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,803 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,787 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,785 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,798 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
PIT4403001:Kmt2b UTSW 7 30,285,114 (GRCm39) missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30,278,996 (GRCm39) missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30,276,217 (GRCm39) splice site probably benign
R0131:Kmt2b UTSW 7 30,283,346 (GRCm39) missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30,273,618 (GRCm39) missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30,276,180 (GRCm39) missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30,274,365 (GRCm39) missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30,279,912 (GRCm39) missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30,276,385 (GRCm39) splice site probably benign
R1599:Kmt2b UTSW 7 30,270,000 (GRCm39) missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30,283,387 (GRCm39) missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30,285,275 (GRCm39) missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30,274,083 (GRCm39) missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30,274,776 (GRCm39) missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30,268,845 (GRCm39) missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30,282,812 (GRCm39) missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30,273,490 (GRCm39) missense probably benign 0.25
R2401:Kmt2b UTSW 7 30,276,133 (GRCm39) missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30,275,493 (GRCm39) missense probably benign 0.10
R3436:Kmt2b UTSW 7 30,276,117 (GRCm39) missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30,273,489 (GRCm39) missense probably benign 0.25
R4259:Kmt2b UTSW 7 30,280,506 (GRCm39) missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30,281,261 (GRCm39) critical splice donor site probably null
R4388:Kmt2b UTSW 7 30,288,015 (GRCm39) unclassified probably benign
R4542:Kmt2b UTSW 7 30,279,684 (GRCm39) missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30,285,783 (GRCm39) unclassified probably benign
R4722:Kmt2b UTSW 7 30,282,627 (GRCm39) missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30,276,186 (GRCm39) nonsense probably null
R4916:Kmt2b UTSW 7 30,277,942 (GRCm39) missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30,269,265 (GRCm39) missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30,269,219 (GRCm39) missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30,281,098 (GRCm39) missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30,279,869 (GRCm39) missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30,276,570 (GRCm39) missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30,287,902 (GRCm39) unclassified probably benign
R6727:Kmt2b UTSW 7 30,283,984 (GRCm39) missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30,285,701 (GRCm39) unclassified probably benign
R7048:Kmt2b UTSW 7 30,268,731 (GRCm39) missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30,279,388 (GRCm39) missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30,281,385 (GRCm39) missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30,268,978 (GRCm39) missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30,282,656 (GRCm39) missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30,279,208 (GRCm39) missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30,276,199 (GRCm39) missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30,268,802 (GRCm39) missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30,268,756 (GRCm39) missense probably damaging 0.98
R8291:Kmt2b UTSW 7 30,284,894 (GRCm39) missense probably damaging 1.00
R8314:Kmt2b UTSW 7 30,278,347 (GRCm39) missense probably damaging 0.99
R8802:Kmt2b UTSW 7 30,283,496 (GRCm39) missense probably damaging 1.00
R8954:Kmt2b UTSW 7 30,273,640 (GRCm39) missense probably damaging 1.00
R9046:Kmt2b UTSW 7 30,285,479 (GRCm39) missense probably benign 0.00
R9225:Kmt2b UTSW 7 30,286,172 (GRCm39) missense unknown
R9258:Kmt2b UTSW 7 30,281,893 (GRCm39) missense probably null 0.99
R9414:Kmt2b UTSW 7 30,282,307 (GRCm39) missense probably damaging 0.99
R9468:Kmt2b UTSW 7 30,284,513 (GRCm39) missense probably damaging 0.98
R9508:Kmt2b UTSW 7 30,269,259 (GRCm39) missense probably damaging 0.99
R9642:Kmt2b UTSW 7 30,283,340 (GRCm39) critical splice donor site probably null
R9667:Kmt2b UTSW 7 30,287,784 (GRCm39) missense unknown
R9709:Kmt2b UTSW 7 30,279,228 (GRCm39) missense probably damaging 0.98
RF001:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF006:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF020:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF021:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
RF030:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF035:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
X0067:Kmt2b UTSW 7 30,278,998 (GRCm39) missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30,284,676 (GRCm39) missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30,276,795 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30,285,841 (GRCm39) missense unknown
Z1177:Kmt2b UTSW 7 30,283,588 (GRCm39) missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30,274,449 (GRCm39) missense probably benign 0.08
Z1186:Kmt2b UTSW 7 30,284,732 (GRCm39) missense probably benign
Z1186:Kmt2b UTSW 7 30,274,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAAAGGATCTCGTAGTCTTC -3'
(R):5'- ACACCTTGTGTAGCTGTCAG -3'

Sequencing Primer
(F):5'- GGATCTCGTAGTCTTCATCTAGAAC -3'
(R):5'- GCTGTCAGATGATGTATACAGCCTC -3'
Posted On 2019-06-26