Mutagenetix > Incidental Mutation

Incidental Mutation 'R7307:Gpr179'

567328

Institutional Source

Beutler Lab

Gene Symbol

Gpr179

Ensembl Gene

ENSMUSG00000070337

Gene Name

G protein-coupled receptor 179

Synonyms

5330439C02Rik

MMRRC Submission

045366-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R7307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97332109-97352077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 97338846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 828 (E828K)

Ref Sequence

ENSEMBL: ENSMUSP00000091474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093942]

AlphaFold

E9PY61

Predicted Effect

probably benign
Transcript: ENSMUST00000093942
AA Change: E828K

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: E828K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	41	N/A	INTRINSIC
EGF	281	357	1.91e1	SMART
Pfam:7tm_3	391	633	3.2e-40	PFAM
low complexity region	735	759	N/A	INTRINSIC
low complexity region	868	880	N/A	INTRINSIC
low complexity region	896	916	N/A	INTRINSIC
low complexity region	959	988	N/A	INTRINSIC
low complexity region	1107	1125	N/A	INTRINSIC
internal_repeat_2	1156	1467	1.99e-12	PROSPERO
internal_repeat_1	1235	1674	2.85e-27	PROSPERO
internal_repeat_2	1569	1879	1.99e-12	PROSPERO
internal_repeat_1	1756	2284	2.85e-27	PROSPERO

Meta Mutation Damage Score

0.0920

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	G	A	16: 17,118,395	P155L	probably benign	Het
Adamts12	G	T	15: 11,217,813	L285F	probably damaging	Het
Ankrd6	A	T	4: 32,816,949	Y393N	possibly damaging	Het
Arhgap45	A	G	10: 80,029,182	Q993R	probably benign	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
B4galnt3	T	C	6: 120,215,431	D448G	probably benign	Het
Capn1	C	G	19: 5,993,908	E564D	possibly damaging	Het
Ccdc85a	A	G	11: 28,399,384	S474P	probably benign	Het
Cdk12	T	A	11: 98,249,800	L1289*	probably null	Het
Cramp1l	A	T	17: 24,974,745	N920K	possibly damaging	Het
Cubn	C	T	2: 13,340,332	S2091N	probably damaging	Het
Ddx1	A	T	12: 13,223,959	I581N	probably damaging	Het
Dnm2	A	T	9: 21,485,687	N487Y	probably damaging	Het
Enc1	A	C	13: 97,245,093	N37T	probably damaging	Het
Ephb3	T	G	16: 21,222,226	I932S	probably benign	Het
Frk	T	A	10: 34,591,938	M316K	probably damaging	Het
Gdap2	C	T	3: 100,202,033	R25C	unknown	Het
Gm10436	A	C	12: 88,181,749	C32W	probably damaging	Het
Gpat2	T	A	2: 127,434,890	D671E	probably damaging	Het
Greb1l	T	C	18: 10,538,142	Y1052H	probably damaging	Het
Gtf2f1	C	T	17: 57,007,833	S69N	probably damaging	Het
Hid1	A	C	11: 115,348,482	I785S	probably damaging	Het
Hmcn2	T	C	2: 31,343,081	I214T	probably damaging	Het
Hsd3b5	G	T	3: 98,619,769	F120L	probably damaging	Het
Kif16b	C	T	2: 142,712,931	R649Q	probably benign	Het
Kif17	A	T	4: 138,262,643	E47D	probably benign	Het
Kmt2b	T	C	7: 30,580,471	H1368R	probably damaging	Het
Kmt2d	A	T	15: 98,849,418	S3342T	unknown	Het
Krt82	A	G	15: 101,542,907	C356R	probably damaging	Het
Lrit2	A	G	14: 37,072,199	K407E	probably benign	Het
Malt1	T	A	18: 65,451,569	H325Q	possibly damaging	Het
Mccc2	T	G	13: 99,988,600	D187A	possibly damaging	Het
Mgll	T	A	6: 88,814,121		probably null	Het
Mindy2	T	G	9: 70,610,959	E449A	possibly damaging	Het
Muc5b	G	A	7: 141,842,294	V96M	unknown	Het
Nlrp4e	A	G	7: 23,321,528	E480G	probably benign	Het
Nup98	A	G	7: 102,134,795	I1093T	probably benign	Het
Olfr1288	A	T	2: 111,478,760		probably benign	Het
Olfr243	G	T	7: 103,716,966	R124L	probably damaging	Het
Olfr350	G	A	2: 36,850,125	M26I	probably benign	Het
Olfr541	G	A	7: 140,705,147	V299I	probably benign	Het
Pcdhb6	A	T	18: 37,335,478	H484L	probably benign	Het
Phldb1	T	C	9: 44,694,047	T604A	possibly damaging	Het
Pitpnm3	G	T	11: 72,070,964	A275D	probably damaging	Het
Polr2a	A	T	11: 69,747,292		probably null	Het
Polr3a	A	G	14: 24,459,987	C960R	probably benign	Het
Pou6f2	G	A	13: 18,239,713	A159V		Het
Pramef6	A	C	4: 143,896,775	Y276*	probably null	Het
Psmc4	A	G	7: 28,042,660	V303A	probably benign	Het
Ptdss2	A	G	7: 141,151,732	N151S	possibly damaging	Het
Ptprk	T	A	10: 28,589,008	Y1295*	probably null	Het
Rbm19	A	G	5: 120,186,218	K881E	possibly damaging	Het
Rcan2	T	A	17: 44,021,102	Y183*	probably null	Het
Rnd1	T	C	15: 98,670,799	E166G	probably damaging	Het
Rnf113a2	T	A	12: 84,418,179	C282S	probably damaging	Het
S100b	G	A	10: 76,257,092	G20R	probably benign	Het
Sae1	G	T	7: 16,368,544	Y168*	probably null	Het
Samd9l	C	A	6: 3,372,600	G1554*	probably null	Het
Samhd1	T	C	2: 157,135,020	S55G	probably benign	Het
Sgsm1	T	C	5: 113,273,646	D525G	probably benign	Het
Slc28a3	A	T	13: 58,563,172	M512K	probably damaging	Het
Slc9b2	T	A	3: 135,318,390	N67K	probably benign	Het
Smarca4	T	A	9: 21,638,800	I402N	probably damaging	Het
St7l	T	C	3: 104,889,353	F261L	probably benign	Het
Syde2	T	A	3: 146,015,798	V1140D	probably damaging	Het
Syt6	T	A	3: 103,587,472	I251N	probably damaging	Het
Taok2	T	C	7: 126,866,818	E916G	probably damaging	Het
Tecta	A	G	9: 42,377,992	S426P	probably damaging	Het
Thra	T	C	11: 98,764,308	I338T	probably damaging	Het
Trub1	A	T	19: 57,472,703	Y137F	probably damaging	Het
Vps13b	T	C	15: 35,841,545	F2574L	probably benign	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het
Zc3h13	T	A	14: 75,330,541	D1091E	probably damaging	Het
Zdhhc6	A	G	19: 55,313,250	Y100H	probably damaging	Het

Other mutations in Gpr179

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Gpr179	APN	11	97337801	missense	probably damaging	0.99
IGL01152:Gpr179	APN	11	97337411	missense	probably benign	0.08
IGL01402:Gpr179	APN	11	97338186	nonsense	probably null
IGL01404:Gpr179	APN	11	97338186	nonsense	probably null
IGL01773:Gpr179	APN	11	97341366	missense	probably benign	0.05
IGL02682:Gpr179	APN	11	97351865	missense	probably benign
IGL02728:Gpr179	APN	11	97337900	missense	probably damaging	0.99
IGL03243:Gpr179	APN	11	97351475	missense	probably benign	0.02
IGL03272:Gpr179	APN	11	97336593	missense	possibly damaging	0.89
IGL03347:Gpr179	APN	11	97351838	missense	probably damaging	1.00
IGL03355:Gpr179	APN	11	97337608	missense	possibly damaging	0.57
PIT4280001:Gpr179	UTSW	11	97344115	missense	probably damaging	1.00
PIT4366001:Gpr179	UTSW	11	97336851	missense	probably benign
R0042:Gpr179	UTSW	11	97334931	missense	probably benign	0.04
R0042:Gpr179	UTSW	11	97334931	missense	probably benign	0.04
R0080:Gpr179	UTSW	11	97351469	missense	probably benign	0.08
R0255:Gpr179	UTSW	11	97336066	missense	probably benign	0.24
R0412:Gpr179	UTSW	11	97338807	missense	probably damaging	1.00
R0481:Gpr179	UTSW	11	97349718	missense	probably damaging	1.00
R0612:Gpr179	UTSW	11	97338438	missense	possibly damaging	0.86
R0786:Gpr179	UTSW	11	97343274	missense	probably damaging	1.00
R1753:Gpr179	UTSW	11	97346578	missense	probably damaging	1.00
R1761:Gpr179	UTSW	11	97335106	missense	probably benign	0.00
R1796:Gpr179	UTSW	11	97336556	missense	possibly damaging	0.86
R1969:Gpr179	UTSW	11	97337958	missense	probably benign
R2240:Gpr179	UTSW	11	97351733	missense	probably damaging	1.00
R3855:Gpr179	UTSW	11	97341434	missense	probably damaging	1.00
R3913:Gpr179	UTSW	11	97334765	missense	probably benign	0.01
R4484:Gpr179	UTSW	11	97335711	missense	probably benign	0.28
R4806:Gpr179	UTSW	11	97349784	missense	possibly damaging	0.55
R4816:Gpr179	UTSW	11	97339248	missense	probably damaging	0.99
R4906:Gpr179	UTSW	11	97346661	missense	possibly damaging	0.87
R4945:Gpr179	UTSW	11	97349718	missense	probably damaging	1.00
R5191:Gpr179	UTSW	11	97338149	missense	possibly damaging	0.76
R5273:Gpr179	UTSW	11	97347430	missense	probably damaging	1.00
R5317:Gpr179	UTSW	11	97337845	missense	probably damaging	1.00
R5459:Gpr179	UTSW	11	97336657	missense	probably benign	0.00
R5507:Gpr179	UTSW	11	97338330	missense	probably damaging	1.00
R5523:Gpr179	UTSW	11	97336782	missense	probably benign	0.37
R5536:Gpr179	UTSW	11	97343815	missense	probably damaging	1.00
R5591:Gpr179	UTSW	11	97345755	missense	probably benign	0.17
R5679:Gpr179	UTSW	11	97336745	missense	probably benign	0.20
R5738:Gpr179	UTSW	11	97351406	missense	probably damaging	1.00
R5829:Gpr179	UTSW	11	97335698	missense	probably benign	0.11
R5836:Gpr179	UTSW	11	97339056	missense	probably benign	0.03
R6007:Gpr179	UTSW	11	97335802	nonsense	probably null
R6047:Gpr179	UTSW	11	97338416	missense	probably damaging	1.00
R6339:Gpr179	UTSW	11	97344176	missense	probably damaging	1.00
R6383:Gpr179	UTSW	11	97337147	missense	possibly damaging	0.88
R6674:Gpr179	UTSW	11	97347405	critical splice donor site	probably null
R6712:Gpr179	UTSW	11	97336167	missense	possibly damaging	0.94
R6835:Gpr179	UTSW	11	97347467	missense	probably damaging	1.00
R6980:Gpr179	UTSW	11	97334858	missense	probably benign	0.38
R7044:Gpr179	UTSW	11	97349790	missense	probably benign	0.19
R7121:Gpr179	UTSW	11	97334730	missense	probably benign	0.00
R7406:Gpr179	UTSW	11	97351594	missense	probably damaging	0.99
R7467:Gpr179	UTSW	11	97335289	missense	probably benign	0.02
R7477:Gpr179	UTSW	11	97335839	missense	possibly damaging	0.87
R7725:Gpr179	UTSW	11	97351292	missense	probably damaging	1.00
R8028:Gpr179	UTSW	11	97337801	missense	probably damaging	0.99
R8165:Gpr179	UTSW	11	97351538	missense	probably benign	0.12
R8262:Gpr179	UTSW	11	97336157	missense	probably benign	0.00
R8674:Gpr179	UTSW	11	97335047	missense	probably benign	0.00
R8695:Gpr179	UTSW	11	97336298	missense	possibly damaging	0.59
R8731:Gpr179	UTSW	11	97343729	missense	probably damaging	1.00
R8791:Gpr179	UTSW	11	97351913	missense	probably damaging	1.00
R8889:Gpr179	UTSW	11	97335764	missense	possibly damaging	0.95
R8892:Gpr179	UTSW	11	97335764	missense	possibly damaging	0.95
R8898:Gpr179	UTSW	11	97351503	nonsense	probably null
R8940:Gpr179	UTSW	11	97337849	missense	probably damaging	1.00
R9266:Gpr179	UTSW	11	97336940	missense	probably benign
R9332:Gpr179	UTSW	11	97338725	missense	probably damaging	1.00
R9440:Gpr179	UTSW	11	97338489	missense	probably benign	0.11
R9557:Gpr179	UTSW	11	97344203	missense	probably damaging	0.97
R9594:Gpr179	UTSW	11	97334901	missense	probably benign	0.13
R9723:Gpr179	UTSW	11	97334720	missense	possibly damaging	0.93
X0065:Gpr179	UTSW	11	97347438	missense	probably benign	0.08
Z1176:Gpr179	UTSW	11	97336648	missense	probably benign	0.05
Z1177:Gpr179	UTSW	11	97351239	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAGAGGAGCCCTTAGAG -3'
(R):5'- CCAGCCTTCAAGAAACGGAG -3'

Sequencing Primer
(F):5'- AGGAGCCCTTAGAGGCCATTC -3'
(R):5'- GCCTTCAAGAAACGGAGAAGCC -3'

Posted On

2019-06-26