Incidental Mutation 'R7215:Prrt1'
ID 568673
Institutional Source Beutler Lab
Gene Symbol Prrt1
Ensembl Gene ENSMUSG00000015476
Gene Name proline-rich transmembrane protein 1
Synonyms NG5, G5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7215 (G1)
Quality Score 43.0073
Status Validated
Chromosome 17
Chromosomal Location 34629533-34633126 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 34629703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015620] [ENSMUST00000064953] [ENSMUST00000166040] [ENSMUST00000167097] [ENSMUST00000168391] [ENSMUST00000169067] [ENSMUST00000169287] [ENSMUST00000170345] [ENSMUST00000171121] [ENSMUST00000171376]
AlphaFold O35449
Predicted Effect probably null
Transcript: ENSMUST00000015620
SMART Domains Protein: ENSMUSP00000015620
Gene: ENSMUSG00000015476

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
low complexity region 57 79 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
Pfam:CD225 214 286 3.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064953
SMART Domains Protein: ENSMUSP00000068071
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166040
SMART Domains Protein: ENSMUSP00000132006
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 289 9e-19 PFAM
Pfam:Abhydrolase_1 37 173 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167097
SMART Domains Protein: ENSMUSP00000125937
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 236 7.7e-12 PFAM
Pfam:Abhydrolase_6 39 236 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168391
SMART Domains Protein: ENSMUSP00000132339
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169067
SMART Domains Protein: ENSMUSP00000127372
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169287
SMART Domains Protein: ENSMUSP00000129421
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
PDB:1PJA|A 1 102 2e-42 PDB
SCOP:d1fj2a_ 29 91 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169969
SMART Domains Protein: ENSMUSP00000127726
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Abhydrolase_1 18 139 9e-8 PFAM
Pfam:Palm_thioest 116 234 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170345
SMART Domains Protein: ENSMUSP00000127707
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 33 203 1.6e-9 PFAM
Pfam:Abhydrolase_6 39 201 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171121
SMART Domains Protein: ENSMUSP00000127745
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171376
SMART Domains Protein: ENSMUSP00000131243
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced mEPSC, reduced LTP, impaired spatial learning, decreased object recognition and increased exploration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Prrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Prrt1 APN 17 34631855 missense possibly damaging 0.68
R1872:Prrt1 UTSW 17 34630951 missense probably damaging 1.00
R5789:Prrt1 UTSW 17 34631957 critical splice donor site probably null
R7139:Prrt1 UTSW 17 34631077 missense probably benign 0.04
R7325:Prrt1 UTSW 17 34632187 missense possibly damaging 0.95
R9258:Prrt1 UTSW 17 34631146 missense probably damaging 1.00
R9260:Prrt1 UTSW 17 34631146 missense probably damaging 1.00
Z1176:Prrt1 UTSW 17 34630833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGACTTCTGAAGCTCTCC -3'
(R):5'- TTGTTGACAAGGGACCAAGG -3'

Sequencing Primer
(F):5'- GCCTCGGTCCCTTTAAGC -3'
(R):5'- TTAGGGCAAGTGGAGGTTA -3'
Posted On 2019-09-06