Incidental Mutation 'R7215:Prrc2b'
ID561363
Institutional Source Beutler Lab
Gene Symbol Prrc2b
Ensembl Gene ENSMUSG00000039262
Gene Nameproline-rich coiled-coil 2B
Synonyms5830434P21Rik, Bat2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32151082-32234537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32229297 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 2172 (G2172R)
Ref Sequence ENSEMBL: ENSMUSP00000064892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]
Predicted Effect probably benign
Transcript: ENSMUST00000036691
SMART Domains Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 194 2.7e-85 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1218 1233 N/A INTRINSIC
low complexity region 1257 1275 N/A INTRINSIC
low complexity region 1402 1421 N/A INTRINSIC
low complexity region 1425 1437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069817
AA Change: G2172R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: G2172R

DomainStartEndE-ValueType
Pfam:BAT2_N 1 191 3.1e-65 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 960 977 N/A INTRINSIC
low complexity region 1004 1018 N/A INTRINSIC
low complexity region 1070 1094 N/A INTRINSIC
low complexity region 1307 1325 N/A INTRINSIC
low complexity region 1388 1401 N/A INTRINSIC
low complexity region 1413 1426 N/A INTRINSIC
low complexity region 1572 1587 N/A INTRINSIC
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1798 1812 N/A INTRINSIC
low complexity region 1904 1919 N/A INTRINSIC
low complexity region 1943 1961 N/A INTRINSIC
low complexity region 2088 2107 N/A INTRINSIC
low complexity region 2111 2123 N/A INTRINSIC
low complexity region 2161 2174 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262
AA Change: G1413R

DomainStartEndE-ValueType
Pfam:BAT2_N 1 119 9.8e-24 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 316 322 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
coiled coil region 421 471 N/A INTRINSIC
low complexity region 528 549 N/A INTRINSIC
low complexity region 566 584 N/A INTRINSIC
low complexity region 813 828 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 1040 1054 N/A INTRINSIC
low complexity region 1146 1161 N/A INTRINSIC
low complexity region 1185 1203 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1353 1365 N/A INTRINSIC
low complexity region 1403 1416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Prrc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Prrc2b APN 2 32208719 missense probably damaging 1.00
IGL00846:Prrc2b APN 2 32199097 splice site probably benign
IGL00977:Prrc2b APN 2 32213810 missense probably benign 0.05
IGL01372:Prrc2b APN 2 32223930 missense probably damaging 0.99
IGL01993:Prrc2b APN 2 32224045 missense possibly damaging 0.47
IGL02097:Prrc2b APN 2 32191501 splice site probably benign
IGL02165:Prrc2b APN 2 32214640 missense probably damaging 1.00
IGL02184:Prrc2b APN 2 32221455 missense probably benign 0.19
IGL02238:Prrc2b APN 2 32213417 missense probably damaging 1.00
IGL02338:Prrc2b APN 2 32214035 missense probably benign 0.01
IGL02399:Prrc2b APN 2 32226961 nonsense probably null
IGL02597:Prrc2b APN 2 32219613 missense probably damaging 1.00
IGL02729:Prrc2b APN 2 32208758 missense probably damaging 0.99
IGL02743:Prrc2b APN 2 32194429 missense probably damaging 1.00
IGL02815:Prrc2b APN 2 32204253 missense probably damaging 1.00
IGL03159:Prrc2b APN 2 32194486 missense probably damaging 0.98
BB002:Prrc2b UTSW 2 32204115 missense probably damaging 1.00
BB012:Prrc2b UTSW 2 32204115 missense probably damaging 1.00
FR4304:Prrc2b UTSW 2 32221167 missense probably damaging 1.00
R0082:Prrc2b UTSW 2 32212298 splice site probably benign
R0105:Prrc2b UTSW 2 32213311 nonsense probably null
R0276:Prrc2b UTSW 2 32219654 missense probably damaging 0.97
R0325:Prrc2b UTSW 2 32199091 missense probably damaging 1.00
R0436:Prrc2b UTSW 2 32230660 missense probably damaging 1.00
R0595:Prrc2b UTSW 2 32183177 missense probably damaging 1.00
R0607:Prrc2b UTSW 2 32213870 missense probably damaging 0.99
R0650:Prrc2b UTSW 2 32229255 splice site probably benign
R1282:Prrc2b UTSW 2 32223444 missense probably damaging 0.96
R1421:Prrc2b UTSW 2 32200978 missense possibly damaging 0.65
R1452:Prrc2b UTSW 2 32194985 missense probably damaging 1.00
R1535:Prrc2b UTSW 2 32204289 missense probably benign 0.06
R1709:Prrc2b UTSW 2 32194461 missense probably damaging 1.00
R1710:Prrc2b UTSW 2 32212222 missense probably damaging 0.99
R2094:Prrc2b UTSW 2 32182570 missense probably damaging 1.00
R2202:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2203:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2204:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2428:Prrc2b UTSW 2 32216055 missense probably benign 0.00
R2435:Prrc2b UTSW 2 32219729 missense probably damaging 0.99
R3439:Prrc2b UTSW 2 32206347 missense probably benign 0.01
R4175:Prrc2b UTSW 2 32218808 intron probably benign
R4710:Prrc2b UTSW 2 32193857 missense possibly damaging 0.80
R4728:Prrc2b UTSW 2 32230625 missense probably damaging 1.00
R4791:Prrc2b UTSW 2 32217339 splice site probably null
R4876:Prrc2b UTSW 2 32214200 missense probably benign 0.00
R4908:Prrc2b UTSW 2 32226318 missense possibly damaging 0.94
R4997:Prrc2b UTSW 2 32222311 missense probably damaging 1.00
R5240:Prrc2b UTSW 2 32206396 missense probably benign 0.01
R5276:Prrc2b UTSW 2 32214722 missense probably benign 0.09
R5455:Prrc2b UTSW 2 32221343 critical splice acceptor site probably null
R5821:Prrc2b UTSW 2 32212132 missense probably damaging 0.99
R5835:Prrc2b UTSW 2 32206473 missense probably benign 0.18
R5958:Prrc2b UTSW 2 32212080 missense possibly damaging 0.89
R6052:Prrc2b UTSW 2 32212285 missense possibly damaging 0.92
R6218:Prrc2b UTSW 2 32208811 missense probably damaging 1.00
R6428:Prrc2b UTSW 2 32226496 splice site probably null
R6505:Prrc2b UTSW 2 32222320 missense probably damaging 1.00
R6812:Prrc2b UTSW 2 32213141 missense probably benign 0.30
R6826:Prrc2b UTSW 2 32222288 critical splice acceptor site probably null
R6827:Prrc2b UTSW 2 32200951 missense probably benign 0.37
R7021:Prrc2b UTSW 2 32221486 missense probably damaging 1.00
R7078:Prrc2b UTSW 2 32213519 missense probably benign 0.01
R7081:Prrc2b UTSW 2 32213063 missense probably benign 0.12
R7101:Prrc2b UTSW 2 32226993 missense possibly damaging 0.68
R7228:Prrc2b UTSW 2 32214306 nonsense probably null
R7566:Prrc2b UTSW 2 32194390 missense probably benign 0.02
R7719:Prrc2b UTSW 2 32217268 nonsense probably null
R7925:Prrc2b UTSW 2 32204115 missense probably damaging 1.00
R7999:Prrc2b UTSW 2 32194414 missense probably damaging 0.96
R8099:Prrc2b UTSW 2 32208674 missense probably benign 0.06
R8154:Prrc2b UTSW 2 32218677 missense probably benign 0.42
R8252:Prrc2b UTSW 2 32219380 missense possibly damaging 0.80
R8379:Prrc2b UTSW 2 32214654 missense probably damaging 0.96
Z1088:Prrc2b UTSW 2 32214429 missense probably benign 0.03
Z1088:Prrc2b UTSW 2 32216732 missense probably damaging 1.00
Z1177:Prrc2b UTSW 2 32226352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTCTTAGCTGTCTCAGG -3'
(R):5'- GAAGTGCTTTTGCCAGGAGG -3'

Sequencing Primer
(F):5'- AGCTGTCTCAGGTCTGTGC -3'
(R):5'- TCAGGTGGCCCAGCTCTAAG -3'
Posted On2019-06-26