Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Prrc2b'

561363

Institutional Source

Beutler Lab

Gene Symbol

Prrc2b

Ensembl Gene

ENSMUSG00000039262

Gene Name

proline-rich coiled-coil 2B

Synonyms

5830434P21Rik, Bat2l

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32151082-32234537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 32229297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 2172 (G2172R)

Ref Sequence

ENSEMBL: ENSMUSP00000064892 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]

AlphaFold

Q7TPM1

Predicted Effect

probably benign
Transcript: ENSMUST00000036691

SMART Domains

Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262

Domain	Start	End	E-Value	Type
Pfam:BAT2_N	1	194	2.7e-85	PFAM
low complexity region	359	374	N/A	INTRINSIC
low complexity region	388	394	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
coiled coil region	494	544	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	638	656	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1218	1233	N/A	INTRINSIC
low complexity region	1257	1275	N/A	INTRINSIC
low complexity region	1402	1421	N/A	INTRINSIC
low complexity region	1425	1437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069817
AA Change: G2172R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: G2172R

Domain	Start	End	E-Value	Type
Pfam:BAT2_N	1	191	3.1e-65	PFAM
low complexity region	359	374	N/A	INTRINSIC
low complexity region	388	394	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
coiled coil region	494	544	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	638	656	N/A	INTRINSIC
low complexity region	960	977	N/A	INTRINSIC
low complexity region	1004	1018	N/A	INTRINSIC
low complexity region	1070	1094	N/A	INTRINSIC
low complexity region	1307	1325	N/A	INTRINSIC
low complexity region	1388	1401	N/A	INTRINSIC
low complexity region	1413	1426	N/A	INTRINSIC
low complexity region	1572	1587	N/A	INTRINSIC
low complexity region	1678	1693	N/A	INTRINSIC
low complexity region	1798	1812	N/A	INTRINSIC
low complexity region	1904	1919	N/A	INTRINSIC
low complexity region	1943	1961	N/A	INTRINSIC
low complexity region	2088	2107	N/A	INTRINSIC
low complexity region	2111	2123	N/A	INTRINSIC
low complexity region	2161	2174	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262
AA Change: G1413R

Domain	Start	End	E-Value	Type
Pfam:BAT2_N	1	119	9.8e-24	PFAM
low complexity region	287	302	N/A	INTRINSIC
low complexity region	316	322	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
coiled coil region	421	471	N/A	INTRINSIC
low complexity region	528	549	N/A	INTRINSIC
low complexity region	566	584	N/A	INTRINSIC
low complexity region	813	828	N/A	INTRINSIC
low complexity region	920	935	N/A	INTRINSIC
low complexity region	1040	1054	N/A	INTRINSIC
low complexity region	1146	1161	N/A	INTRINSIC
low complexity region	1185	1203	N/A	INTRINSIC
low complexity region	1330	1349	N/A	INTRINSIC
low complexity region	1353	1365	N/A	INTRINSIC
low complexity region	1403	1416	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Prrc2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Prrc2b	APN	2	32208719	missense	probably damaging	1.00
IGL00846:Prrc2b	APN	2	32199097	splice site	probably benign
IGL00977:Prrc2b	APN	2	32213810	missense	probably benign	0.05
IGL01372:Prrc2b	APN	2	32223930	missense	probably damaging	0.99
IGL01993:Prrc2b	APN	2	32224045	missense	possibly damaging	0.47
IGL02097:Prrc2b	APN	2	32191501	splice site	probably benign
IGL02165:Prrc2b	APN	2	32214640	missense	probably damaging	1.00
IGL02184:Prrc2b	APN	2	32221455	missense	probably benign	0.19
IGL02238:Prrc2b	APN	2	32213417	missense	probably damaging	1.00
IGL02338:Prrc2b	APN	2	32214035	missense	probably benign	0.01
IGL02399:Prrc2b	APN	2	32226961	nonsense	probably null
IGL02597:Prrc2b	APN	2	32219613	missense	probably damaging	1.00
IGL02729:Prrc2b	APN	2	32208758	missense	probably damaging	0.99
IGL02743:Prrc2b	APN	2	32194429	missense	probably damaging	1.00
IGL02815:Prrc2b	APN	2	32204253	missense	probably damaging	1.00
IGL03159:Prrc2b	APN	2	32194486	missense	probably damaging	0.98
BB002:Prrc2b	UTSW	2	32204115	missense	probably damaging	1.00
BB012:Prrc2b	UTSW	2	32204115	missense	probably damaging	1.00
FR4304:Prrc2b	UTSW	2	32221167	missense	probably damaging	1.00
R0082:Prrc2b	UTSW	2	32212298	splice site	probably benign
R0105:Prrc2b	UTSW	2	32213311	nonsense	probably null
R0276:Prrc2b	UTSW	2	32219654	missense	probably damaging	0.97
R0325:Prrc2b	UTSW	2	32199091	missense	probably damaging	1.00
R0436:Prrc2b	UTSW	2	32230660	missense	probably damaging	1.00
R0595:Prrc2b	UTSW	2	32183177	missense	probably damaging	1.00
R0607:Prrc2b	UTSW	2	32213870	missense	probably damaging	0.99
R0650:Prrc2b	UTSW	2	32229255	splice site	probably benign
R1282:Prrc2b	UTSW	2	32223444	missense	probably damaging	0.96
R1421:Prrc2b	UTSW	2	32200978	missense	possibly damaging	0.65
R1452:Prrc2b	UTSW	2	32194985	missense	probably damaging	1.00
R1535:Prrc2b	UTSW	2	32204289	missense	probably benign	0.06
R1709:Prrc2b	UTSW	2	32194461	missense	probably damaging	1.00
R1710:Prrc2b	UTSW	2	32212222	missense	probably damaging	0.99
R2094:Prrc2b	UTSW	2	32182570	missense	probably damaging	1.00
R2202:Prrc2b	UTSW	2	32223464	missense	probably damaging	1.00
R2203:Prrc2b	UTSW	2	32223464	missense	probably damaging	1.00
R2204:Prrc2b	UTSW	2	32223464	missense	probably damaging	1.00
R2428:Prrc2b	UTSW	2	32216055	missense	probably benign	0.00
R2435:Prrc2b	UTSW	2	32219729	missense	probably damaging	0.99
R3439:Prrc2b	UTSW	2	32206347	missense	probably benign	0.01
R4175:Prrc2b	UTSW	2	32218808	intron	probably benign
R4710:Prrc2b	UTSW	2	32193857	missense	possibly damaging	0.80
R4728:Prrc2b	UTSW	2	32230625	missense	probably damaging	1.00
R4791:Prrc2b	UTSW	2	32217339	splice site	probably null
R4876:Prrc2b	UTSW	2	32214200	missense	probably benign	0.00
R4908:Prrc2b	UTSW	2	32226318	missense	possibly damaging	0.94
R4997:Prrc2b	UTSW	2	32222311	missense	probably damaging	1.00
R5240:Prrc2b	UTSW	2	32206396	missense	probably benign	0.01
R5276:Prrc2b	UTSW	2	32214722	missense	probably benign	0.09
R5455:Prrc2b	UTSW	2	32221343	critical splice acceptor site	probably null
R5821:Prrc2b	UTSW	2	32212132	missense	probably damaging	0.99
R5835:Prrc2b	UTSW	2	32206473	missense	probably benign	0.18
R5958:Prrc2b	UTSW	2	32212080	missense	possibly damaging	0.89
R6052:Prrc2b	UTSW	2	32212285	missense	possibly damaging	0.92
R6218:Prrc2b	UTSW	2	32208811	missense	probably damaging	1.00
R6428:Prrc2b	UTSW	2	32226496	splice site	probably null
R6505:Prrc2b	UTSW	2	32222320	missense	probably damaging	1.00
R6812:Prrc2b	UTSW	2	32213141	missense	probably benign	0.30
R6826:Prrc2b	UTSW	2	32222288	critical splice acceptor site	probably null
R6827:Prrc2b	UTSW	2	32200951	missense	probably benign	0.37
R7021:Prrc2b	UTSW	2	32221486	missense	probably damaging	1.00
R7078:Prrc2b	UTSW	2	32213519	missense	probably benign	0.01
R7081:Prrc2b	UTSW	2	32213063	missense	probably benign	0.12
R7101:Prrc2b	UTSW	2	32226993	missense	possibly damaging	0.68
R7228:Prrc2b	UTSW	2	32214306	nonsense	probably null
R7566:Prrc2b	UTSW	2	32194390	missense	probably benign	0.02
R7719:Prrc2b	UTSW	2	32217268	nonsense	probably null
R7925:Prrc2b	UTSW	2	32204115	missense	probably damaging	1.00
R7999:Prrc2b	UTSW	2	32194414	missense	probably damaging	0.96
R8099:Prrc2b	UTSW	2	32208674	missense	probably benign	0.06
R8154:Prrc2b	UTSW	2	32218677	missense	probably benign	0.42
R8252:Prrc2b	UTSW	2	32219380	missense	possibly damaging	0.80
R8379:Prrc2b	UTSW	2	32214654	missense	probably damaging	0.96
R8485:Prrc2b	UTSW	2	32212093	missense	possibly damaging	0.83
R8845:Prrc2b	UTSW	2	32212093	missense	possibly damaging	0.83
R8845:Prrc2b	UTSW	2	32216150	missense	possibly damaging	0.89
R8919:Prrc2b	UTSW	2	32214941	missense	probably benign
R8982:Prrc2b	UTSW	2	32212122	missense	probably damaging	1.00
R9065:Prrc2b	UTSW	2	32219292	missense	probably damaging	0.99
R9127:Prrc2b	UTSW	2	32213752	missense	probably damaging	1.00
R9217:Prrc2b	UTSW	2	32213402	missense	probably damaging	1.00
R9338:Prrc2b	UTSW	2	32208767	missense	probably damaging	1.00
R9344:Prrc2b	UTSW	2	32213588	missense	probably benign	0.28
R9386:Prrc2b	UTSW	2	32214113	missense	probably benign
R9601:Prrc2b	UTSW	2	32200941	missense	probably damaging	1.00
R9607:Prrc2b	UTSW	2	32208782	missense	probably damaging	0.99
R9670:Prrc2b	UTSW	2	32213187	missense	probably benign	0.00
R9706:Prrc2b	UTSW	2	32217288	missense	probably benign	0.00
Z1088:Prrc2b	UTSW	2	32214429	missense	probably benign	0.03
Z1088:Prrc2b	UTSW	2	32216732	missense	probably damaging	1.00
Z1177:Prrc2b	UTSW	2	32226352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATTCTTAGCTGTCTCAGG -3'
(R):5'- GAAGTGCTTTTGCCAGGAGG -3'

Sequencing Primer
(F):5'- AGCTGTCTCAGGTCTGTGC -3'
(R):5'- TCAGGTGGCCCAGCTCTAAG -3'

Posted On

2019-06-26