Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:2210408I21Rik'

561412

Institutional Source

Beutler Lab

Gene Symbol

2210408I21Rik

Ensembl Gene

ENSMUSG00000071252

Gene Name

RIKEN cDNA 2210408I21 gene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77135540-77613784 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77323571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1032 (V1032M)

Ref Sequence

ENSEMBL: ENSMUSP00000127449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168779]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168779
AA Change: V1032M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: V1032M

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	151	164	N/A	INTRINSIC
Pfam:DUF4495	515	832	1.6e-140	PFAM
low complexity region	1241	1255	N/A	INTRINSIC

Meta Mutation Damage Score

0.1609

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in 2210408I21Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:2210408I21Rik	APN	13	77323358	splice site	probably benign
IGL01154:2210408I21Rik	APN	13	77281094	missense	probably benign	0.01
IGL01461:2210408I21Rik	APN	13	77281095	missense	probably benign	0.25
IGL01624:2210408I21Rik	APN	13	77193086	missense	probably damaging	0.99
IGL02033:2210408I21Rik	APN	13	77259876	missense	possibly damaging	0.90
IGL02621:2210408I21Rik	APN	13	77260031	missense	possibly damaging	0.92
IGL02718:2210408I21Rik	APN	13	77174872	missense	probably damaging	1.00
IGL02823:2210408I21Rik	APN	13	77261955	missense	probably damaging	0.96
IGL02859:2210408I21Rik	APN	13	77267699	missense	possibly damaging	0.71
IGL03006:2210408I21Rik	APN	13	77323772	critical splice donor site	probably null
IGL03072:2210408I21Rik	APN	13	77259997	missense	probably benign
IGL03184:2210408I21Rik	APN	13	77323451	missense	possibly damaging	0.63
IGL03275:2210408I21Rik	APN	13	77298555	missense	possibly damaging	0.71
PIT4651001:2210408I21Rik	UTSW	13	77259895	missense	probably benign
R0226:2210408I21Rik	UTSW	13	77303425	missense	possibly damaging	0.86
R0323:2210408I21Rik	UTSW	13	77298555	missense	possibly damaging	0.71
R0614:2210408I21Rik	UTSW	13	77192663	missense	probably benign	0.26
R0894:2210408I21Rik	UTSW	13	77323607	missense	probably benign	0.18
R1165:2210408I21Rik	UTSW	13	77334287	missense	probably benign	0.06
R1509:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R1711:2210408I21Rik	UTSW	13	77269920	missense	possibly damaging	0.93
R1714:2210408I21Rik	UTSW	13	77316360	missense	possibly damaging	0.86
R1718:2210408I21Rik	UTSW	13	77245370	intron	probably benign
R1836:2210408I21Rik	UTSW	13	77323374	missense	probably benign	0.00
R1893:2210408I21Rik	UTSW	13	77267809	missense	possibly damaging	0.93
R2035:2210408I21Rik	UTSW	13	77612642	makesense	probably null
R2329:2210408I21Rik	UTSW	13	77303325	missense	probably benign	0.04
R2897:2210408I21Rik	UTSW	13	77323521	missense	probably benign	0.33
R3688:2210408I21Rik	UTSW	13	77267849	missense	possibly damaging	0.52
R4153:2210408I21Rik	UTSW	13	77193173	missense	probably benign	0.00
R4387:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4388:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4499:2210408I21Rik	UTSW	13	77316527	missense	possibly damaging	0.96
R4614:2210408I21Rik	UTSW	13	77254256	splice site	probably null
R4798:2210408I21Rik	UTSW	13	77323724	missense	possibly damaging	0.96
R4943:2210408I21Rik	UTSW	13	77245327	missense	possibly damaging	0.86
R5045:2210408I21Rik	UTSW	13	77267808	splice site	probably null
R5387:2210408I21Rik	UTSW	13	77259973	missense	probably benign	0.11
R5500:2210408I21Rik	UTSW	13	77303389	missense	probably benign	0.33
R5686:2210408I21Rik	UTSW	13	77303314	missense	possibly damaging	0.72
R6111:2210408I21Rik	UTSW	13	77327902	missense	possibly damaging	0.72
R6135:2210408I21Rik	UTSW	13	77254216	missense	probably damaging	0.98
R6188:2210408I21Rik	UTSW	13	77183731	missense	possibly damaging	0.53
R6388:2210408I21Rik	UTSW	13	77262111	missense	probably benign
R6588:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R6632:2210408I21Rik	UTSW	13	77281067	missense	possibly damaging	0.86
R6638:2210408I21Rik	UTSW	13	77303402	missense	probably benign	0.07
R6755:2210408I21Rik	UTSW	13	77327875	missense	probably benign
R6971:2210408I21Rik	UTSW	13	77193187	missense	possibly damaging	0.90
R7079:2210408I21Rik	UTSW	13	77254204	missense	possibly damaging	0.86
R7130:2210408I21Rik	UTSW	13	77269902	missense	possibly damaging	0.93
R7272:2210408I21Rik	UTSW	13	77323536	missense	probably benign	0.00
R7331:2210408I21Rik	UTSW	13	77183609	missense	possibly damaging	0.53
R7561:2210408I21Rik	UTSW	13	77193195	missense	probably benign
R7684:2210408I21Rik	UTSW	13	77612540	nonsense	probably null
R7728:2210408I21Rik	UTSW	13	77316477	missense	possibly damaging	0.96
R7881:2210408I21Rik	UTSW	13	77323566	missense	possibly damaging	0.53
R7963:2210408I21Rik	UTSW	13	77192554	missense	probably benign	0.02
R8008:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8024:2210408I21Rik	UTSW	13	77612594	missense	probably benign
R8170:2210408I21Rik	UTSW	13	77263594	missense	probably benign	0.06
R8201:2210408I21Rik	UTSW	13	77193159	missense	possibly damaging	0.72
R8255:2210408I21Rik	UTSW	13	77267731	missense	possibly damaging	0.71
R8296:2210408I21Rik	UTSW	13	77267777	missense	probably damaging	0.98
R8476:2210408I21Rik	UTSW	13	77261901	missense	possibly damaging	0.92
R8526:2210408I21Rik	UTSW	13	77269816	nonsense	probably null
R8746:2210408I21Rik	UTSW	13	77303410	missense	probably benign	0.01
R8812:2210408I21Rik	UTSW	13	77332352	missense	probably damaging	0.98
R8870:2210408I21Rik	UTSW	13	77323721	missense	possibly damaging	0.96
R8885:2210408I21Rik	UTSW	13	77323406	missense	possibly damaging	0.91
R8910:2210408I21Rik	UTSW	13	77323649	missense	probably benign	0.03
R8911:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8965:2210408I21Rik	UTSW	13	77612604	missense	probably benign	0.02
R8968:2210408I21Rik	UTSW	13	77332310	nonsense	probably null
R8989:2210408I21Rik	UTSW	13	77612605	missense	probably benign	0.01
R9163:2210408I21Rik	UTSW	13	77245281	missense	possibly damaging	0.73
R9378:2210408I21Rik	UTSW	13	77323616	missense	possibly damaging	0.53
R9478:2210408I21Rik	UTSW	13	77303454	missense	possibly damaging	0.53
R9523:2210408I21Rik	UTSW	13	77259869	missense	possibly damaging	0.53
R9595:2210408I21Rik	UTSW	13	77316447	missense	probably benign
X0066:2210408I21Rik	UTSW	13	77183640	missense	possibly damaging	0.72
Z1088:2210408I21Rik	UTSW	13	77174891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGTGTCTATTGTCCTCAG -3'
(R):5'- AGAGACAGGCATGGCTTTACC -3'

Sequencing Primer
(F):5'- CCTCAGCAAGTTACCTACAGTGATTG -3'
(R):5'- ACCATTGGATGCTCAGTGTC -3'

Posted On

2019-06-26