Mutagenetix > Incidental Mutation

Incidental Mutation 'R7517:Cdan1'

582506

Institutional Source

Beutler Lab

Gene Symbol

Cdan1

Ensembl Gene

ENSMUSG00000027284

Gene Name

congenital dyserythropoietic anemia, type I (human)

Synonyms

codanin-1, CDA-I, CDA1, 1500015A01Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120716154-120850128 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120727924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 469 (R469Q)

Ref Sequence

ENSEMBL: ENSMUSP00000106329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]

AlphaFold

Q8CC12

Predicted Effect

probably benign
Transcript: ENSMUST00000028740

SMART Domains

Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100

Domain	Start	End	E-Value	Type
Pfam:Pkinase	90	347	7e-31	PFAM
Pfam:Pkinase_Tyr	90	348	8.2e-19	PFAM
low complexity region	369	383	N/A	INTRINSIC
low complexity region	1143	1156	N/A	INTRINSIC
low complexity region	1205	1242	N/A	INTRINSIC
low complexity region	1254	1271	N/A	INTRINSIC
low complexity region	1285	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000057135

SMART Domains

Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100

Domain	Start	End	E-Value	Type
Pfam:Pkinase	21	274	1.2e-32	PFAM
Pfam:Pkinase_Tyr	21	280	3.8e-19	PFAM
low complexity region	300	314	N/A	INTRINSIC
low complexity region	1074	1087	N/A	INTRINSIC
low complexity region	1136	1173	N/A	INTRINSIC
low complexity region	1185	1202	N/A	INTRINSIC
low complexity region	1216	1240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085840

SMART Domains

Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100

Domain	Start	End	E-Value	Type
Pfam:Pkinase	21	274	1.2e-32	PFAM
Pfam:Pkinase_Tyr	21	280	3.8e-19	PFAM
low complexity region	300	314	N/A	INTRINSIC
low complexity region	1074	1087	N/A	INTRINSIC
low complexity region	1136	1173	N/A	INTRINSIC
low complexity region	1185	1202	N/A	INTRINSIC
low complexity region	1216	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110700
AA Change: R469Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: R469Q

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	102	151	N/A	INTRINSIC
low complexity region	154	180	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	786	906	2.4e-48	PFAM
low complexity region	1157	1171	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110701
AA Change: R469Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: R469Q

Domain	Start	End	E-Value	Type
low complexity region	77	98	N/A	INTRINSIC
low complexity region	101	150	N/A	INTRINSIC
low complexity region	153	179	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	789	904	2.4e-41	PFAM
low complexity region	1164	1178	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154193

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Cacna2d4	C	T	6: 119,271,921	R448C	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Gtf2ird1	T	C	5: 134,362,525	D899G	probably benign	Het
Hipk3	T	C	2: 104,434,714	T674A	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Mpp7	G	A	18: 7,440,183	Q263*	probably null	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Tgm3	T	G	2: 130,041,764	S447R	probably benign	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Unc13b	C	A	4: 43,215,765	S21R	probably benign	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Cdan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Cdan1	APN	2	120725985	missense	probably damaging	1.00
IGL01660:Cdan1	APN	2	120725653	missense	possibly damaging	0.63
IGL01930:Cdan1	APN	2	120726582	intron	probably benign
IGL02597:Cdan1	APN	2	120725239	missense	probably benign	0.08
IGL03025:Cdan1	APN	2	120730741	missense	probably damaging	1.00
IGL03130:Cdan1	APN	2	120727912	missense	possibly damaging	0.94
IGL03388:Cdan1	APN	2	120730511	utr 3 prime	probably benign
FR4737:Cdan1	UTSW	2	120724971	missense	probably damaging	0.96
R0001:Cdan1	UTSW	2	120723751	missense	probably benign	0.41
R0650:Cdan1	UTSW	2	120726045	missense	probably benign	0.00
R0781:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R0881:Cdan1	UTSW	2	120720985	missense	probably damaging	1.00
R1110:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R1345:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1370:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1503:Cdan1	UTSW	2	120729575	missense	probably damaging	1.00
R1579:Cdan1	UTSW	2	120730739	missense	probably damaging	0.98
R1664:Cdan1	UTSW	2	120720506	missense	probably damaging	0.99
R1749:Cdan1	UTSW	2	120729799	missense	probably damaging	0.96
R1765:Cdan1	UTSW	2	120720749	missense	probably damaging	1.00
R1806:Cdan1	UTSW	2	120731426	utr 3 prime	probably benign
R1856:Cdan1	UTSW	2	120724936	missense	probably benign
R2202:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2203:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2204:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120725632	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120731020	utr 3 prime	probably benign
R4060:Cdan1	UTSW	2	120725743	missense	probably benign	0.00
R4324:Cdan1	UTSW	2	120724979	missense	probably damaging	0.97
R4379:Cdan1	UTSW	2	120726618	missense	probably damaging	1.00
R4611:Cdan1	UTSW	2	120730720	missense	probably damaging	0.96
R4695:Cdan1	UTSW	2	120728383	missense	probably damaging	1.00
R4866:Cdan1	UTSW	2	120731447	utr 3 prime	probably benign
R5183:Cdan1	UTSW	2	120729580	missense	probably damaging	0.96
R5347:Cdan1	UTSW	2	120730065	missense	possibly damaging	0.95
R5789:Cdan1	UTSW	2	120729535	missense	probably benign	0.22
R5958:Cdan1	UTSW	2	120723902	missense	possibly damaging	0.80
R6608:Cdan1	UTSW	2	120726680	missense	possibly damaging	0.78
R7055:Cdan1	UTSW	2	120727861	missense	probably damaging	0.97
R7065:Cdan1	UTSW	2	120718921	missense	probably benign	0.00
R7225:Cdan1	UTSW	2	120724912	missense	probably benign
R7238:Cdan1	UTSW	2	120730302	missense	probably benign
R7316:Cdan1	UTSW	2	120728332	critical splice donor site	probably null
R7325:Cdan1	UTSW	2	120724704	missense	probably benign	0.25
R7432:Cdan1	UTSW	2	120722755	missense	probably damaging	1.00
R7691:Cdan1	UTSW	2	120729567	missense	probably damaging	1.00
R8004:Cdan1	UTSW	2	120731443	missense	unknown
R8324:Cdan1	UTSW	2	120727325	missense	probably benign	0.07
R8465:Cdan1	UTSW	2	120728440	missense	possibly damaging	0.93
R8556:Cdan1	UTSW	2	120722990	missense	probably damaging	1.00
R8932:Cdan1	UTSW	2	120731087	nonsense	probably null
R9462:Cdan1	UTSW	2	120729579	missense	possibly damaging	0.87
R9718:Cdan1	UTSW	2	120724169	missense	probably damaging	1.00
X0050:Cdan1	UTSW	2	120724145	missense	probably benign	0.29
Z1088:Cdan1	UTSW	2	120730336	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAAATCCCTTTTGTTCTAGGTAGG -3'
(R):5'- CAGATGCCTGTGATGTGCTG -3'

Sequencing Primer
(F):5'- CTAGGTAGGTCGAGTTACCAATAAC -3'
(R):5'- GCTGCTGGGTCTGTAACATTACC -3'

Posted On

2019-10-17