Incidental Mutation 'R7517:Cdan1'
ID582506
Institutional Source Beutler Lab
Gene Symbol Cdan1
Ensembl Gene ENSMUSG00000027284
Gene Namecongenital dyserythropoietic anemia, type I (human)
Synonymscodanin-1, CDA-I, CDA1, 1500015A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120716154-120850128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120727924 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 469 (R469Q)
Ref Sequence ENSEMBL: ENSMUSP00000106329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]
Predicted Effect probably benign
Transcript: ENSMUST00000028740
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110700
AA Change: R469Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: R469Q

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110701
AA Change: R469Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: R469Q

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Cdan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Cdan1 APN 2 120725985 missense probably damaging 1.00
IGL01660:Cdan1 APN 2 120725653 missense possibly damaging 0.63
IGL01930:Cdan1 APN 2 120726582 intron probably benign
IGL02597:Cdan1 APN 2 120725239 missense probably benign 0.08
IGL03025:Cdan1 APN 2 120730741 missense probably damaging 1.00
IGL03130:Cdan1 APN 2 120727912 missense possibly damaging 0.94
IGL03388:Cdan1 APN 2 120730511 utr 3 prime probably benign
FR4737:Cdan1 UTSW 2 120724971 missense probably damaging 0.96
R0001:Cdan1 UTSW 2 120723751 missense probably benign 0.41
R0650:Cdan1 UTSW 2 120726045 missense probably benign 0.00
R0781:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R0881:Cdan1 UTSW 2 120720985 missense probably damaging 1.00
R1110:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R1345:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1370:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1503:Cdan1 UTSW 2 120729575 missense probably damaging 1.00
R1579:Cdan1 UTSW 2 120730739 missense probably damaging 0.98
R1664:Cdan1 UTSW 2 120720506 missense probably damaging 0.99
R1749:Cdan1 UTSW 2 120729799 missense probably damaging 0.96
R1765:Cdan1 UTSW 2 120720749 missense probably damaging 1.00
R1806:Cdan1 UTSW 2 120731426 utr 3 prime probably benign
R1856:Cdan1 UTSW 2 120724936 missense probably benign
R2202:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2203:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2204:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120725632 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120731020 utr 3 prime probably benign
R4060:Cdan1 UTSW 2 120725743 missense probably benign 0.00
R4324:Cdan1 UTSW 2 120724979 missense probably damaging 0.97
R4379:Cdan1 UTSW 2 120726618 missense probably damaging 1.00
R4611:Cdan1 UTSW 2 120730720 missense probably damaging 0.96
R4695:Cdan1 UTSW 2 120728383 missense probably damaging 1.00
R4866:Cdan1 UTSW 2 120731447 utr 3 prime probably benign
R5183:Cdan1 UTSW 2 120729580 missense probably damaging 0.96
R5347:Cdan1 UTSW 2 120730065 missense possibly damaging 0.95
R5789:Cdan1 UTSW 2 120729535 missense probably benign 0.22
R5958:Cdan1 UTSW 2 120723902 missense possibly damaging 0.80
R6608:Cdan1 UTSW 2 120726680 missense possibly damaging 0.78
R7055:Cdan1 UTSW 2 120727861 missense probably damaging 0.97
R7065:Cdan1 UTSW 2 120718921 missense probably benign 0.00
R7225:Cdan1 UTSW 2 120724912 missense probably benign
R7238:Cdan1 UTSW 2 120730302 missense probably benign
R7316:Cdan1 UTSW 2 120728332 critical splice donor site probably null
R7325:Cdan1 UTSW 2 120724704 missense probably benign 0.25
R7432:Cdan1 UTSW 2 120722755 missense probably damaging 1.00
R7691:Cdan1 UTSW 2 120729567 missense probably damaging 1.00
R8004:Cdan1 UTSW 2 120731443 missense unknown
R8324:Cdan1 UTSW 2 120727325 missense probably benign 0.07
R8465:Cdan1 UTSW 2 120728440 missense possibly damaging 0.93
R8556:Cdan1 UTSW 2 120722990 missense probably damaging 1.00
X0050:Cdan1 UTSW 2 120724145 missense probably benign 0.29
Z1088:Cdan1 UTSW 2 120730336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAATCCCTTTTGTTCTAGGTAGG -3'
(R):5'- CAGATGCCTGTGATGTGCTG -3'

Sequencing Primer
(F):5'- CTAGGTAGGTCGAGTTACCAATAAC -3'
(R):5'- GCTGCTGGGTCTGTAACATTACC -3'
Posted On2019-10-17