Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Cdan1'

643968

Institutional Source

Beutler Lab

Gene Symbol

Cdan1

Ensembl Gene

ENSMUSG00000027284

Gene Name

congenital dyserythropoietic anemia, type I (human)

Synonyms

codanin-1, CDA-I, CDA1, 1500015A01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120716154-120850128 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120727325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 507 (V507A)

Ref Sequence

ENSEMBL: ENSMUSP00000106329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]

AlphaFold

Q8CC12

Predicted Effect

probably benign
Transcript: ENSMUST00000110700
AA Change: V507A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: V507A

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	102	151	N/A	INTRINSIC
low complexity region	154	180	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	786	906	2.4e-48	PFAM
low complexity region	1157	1171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110701
AA Change: V507A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: V507A

Domain	Start	End	E-Value	Type
low complexity region	77	98	N/A	INTRINSIC
low complexity region	101	150	N/A	INTRINSIC
low complexity region	153	179	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	789	904	2.4e-41	PFAM
low complexity region	1164	1178	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154193

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Itpr2	T	C	6: 146,328,398	E1233G	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Cdan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Cdan1	APN	2	120725985	missense	probably damaging	1.00
IGL01660:Cdan1	APN	2	120725653	missense	possibly damaging	0.63
IGL01930:Cdan1	APN	2	120726582	intron	probably benign
IGL02597:Cdan1	APN	2	120725239	missense	probably benign	0.08
IGL03025:Cdan1	APN	2	120730741	missense	probably damaging	1.00
IGL03130:Cdan1	APN	2	120727912	missense	possibly damaging	0.94
IGL03388:Cdan1	APN	2	120730511	utr 3 prime	probably benign
FR4737:Cdan1	UTSW	2	120724971	missense	probably damaging	0.96
R0001:Cdan1	UTSW	2	120723751	missense	probably benign	0.41
R0650:Cdan1	UTSW	2	120726045	missense	probably benign	0.00
R0781:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R0881:Cdan1	UTSW	2	120720985	missense	probably damaging	1.00
R1110:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R1345:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1370:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1503:Cdan1	UTSW	2	120729575	missense	probably damaging	1.00
R1579:Cdan1	UTSW	2	120730739	missense	probably damaging	0.98
R1664:Cdan1	UTSW	2	120720506	missense	probably damaging	0.99
R1749:Cdan1	UTSW	2	120729799	missense	probably damaging	0.96
R1765:Cdan1	UTSW	2	120720749	missense	probably damaging	1.00
R1806:Cdan1	UTSW	2	120731426	utr 3 prime	probably benign
R1856:Cdan1	UTSW	2	120724936	missense	probably benign
R2202:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2203:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2204:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120725632	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120731020	utr 3 prime	probably benign
R4060:Cdan1	UTSW	2	120725743	missense	probably benign	0.00
R4324:Cdan1	UTSW	2	120724979	missense	probably damaging	0.97
R4379:Cdan1	UTSW	2	120726618	missense	probably damaging	1.00
R4611:Cdan1	UTSW	2	120730720	missense	probably damaging	0.96
R4695:Cdan1	UTSW	2	120728383	missense	probably damaging	1.00
R4866:Cdan1	UTSW	2	120731447	utr 3 prime	probably benign
R5183:Cdan1	UTSW	2	120729580	missense	probably damaging	0.96
R5347:Cdan1	UTSW	2	120730065	missense	possibly damaging	0.95
R5789:Cdan1	UTSW	2	120729535	missense	probably benign	0.22
R5958:Cdan1	UTSW	2	120723902	missense	possibly damaging	0.80
R6608:Cdan1	UTSW	2	120726680	missense	possibly damaging	0.78
R7055:Cdan1	UTSW	2	120727861	missense	probably damaging	0.97
R7065:Cdan1	UTSW	2	120718921	missense	probably benign	0.00
R7225:Cdan1	UTSW	2	120724912	missense	probably benign
R7238:Cdan1	UTSW	2	120730302	missense	probably benign
R7316:Cdan1	UTSW	2	120728332	critical splice donor site	probably null
R7325:Cdan1	UTSW	2	120724704	missense	probably benign	0.25
R7432:Cdan1	UTSW	2	120722755	missense	probably damaging	1.00
R7517:Cdan1	UTSW	2	120727924	missense	probably damaging	1.00
R7691:Cdan1	UTSW	2	120729567	missense	probably damaging	1.00
R8004:Cdan1	UTSW	2	120731443	missense	unknown
R8465:Cdan1	UTSW	2	120728440	missense	possibly damaging	0.93
R8556:Cdan1	UTSW	2	120722990	missense	probably damaging	1.00
R8932:Cdan1	UTSW	2	120731087	nonsense	probably null
R9462:Cdan1	UTSW	2	120729579	missense	possibly damaging	0.87
R9718:Cdan1	UTSW	2	120724169	missense	probably damaging	1.00
X0050:Cdan1	UTSW	2	120724145	missense	probably benign	0.29
Z1088:Cdan1	UTSW	2	120730336	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATGCCCGCCAAATTTGAAC -3'
(R):5'- TGGCCTGAAGATCTGAGAGG -3'

Sequencing Primer
(F):5'- ATGCCCGCCAAATTTGAACTATCTC -3'
(R):5'- CCTGAAGATCTGAGAGGGCATTTC -3'

Posted On

2020-09-02