Incidental Mutation 'R8324:Cdan1'
ID 643968
Institutional Source Beutler Lab
Gene Symbol Cdan1
Ensembl Gene ENSMUSG00000027284
Gene Name congenital dyserythropoietic anemia, type I (human)
Synonyms codanin-1, CDA-I, CDA1, 1500015A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120716154-120850128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120727325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 507 (V507A)
Ref Sequence ENSEMBL: ENSMUSP00000106329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]
AlphaFold Q8CC12
Predicted Effect probably benign
Transcript: ENSMUST00000110700
AA Change: V507A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: V507A

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110701
AA Change: V507A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: V507A

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rictor T A 15: 6,745,562 V125E probably damaging Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Cdan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Cdan1 APN 2 120725985 missense probably damaging 1.00
IGL01660:Cdan1 APN 2 120725653 missense possibly damaging 0.63
IGL01930:Cdan1 APN 2 120726582 intron probably benign
IGL02597:Cdan1 APN 2 120725239 missense probably benign 0.08
IGL03025:Cdan1 APN 2 120730741 missense probably damaging 1.00
IGL03130:Cdan1 APN 2 120727912 missense possibly damaging 0.94
IGL03388:Cdan1 APN 2 120730511 utr 3 prime probably benign
FR4737:Cdan1 UTSW 2 120724971 missense probably damaging 0.96
R0001:Cdan1 UTSW 2 120723751 missense probably benign 0.41
R0650:Cdan1 UTSW 2 120726045 missense probably benign 0.00
R0781:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R0881:Cdan1 UTSW 2 120720985 missense probably damaging 1.00
R1110:Cdan1 UTSW 2 120720602 missense probably damaging 1.00
R1345:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1370:Cdan1 UTSW 2 120719139 critical splice donor site probably null
R1503:Cdan1 UTSW 2 120729575 missense probably damaging 1.00
R1579:Cdan1 UTSW 2 120730739 missense probably damaging 0.98
R1664:Cdan1 UTSW 2 120720506 missense probably damaging 0.99
R1749:Cdan1 UTSW 2 120729799 missense probably damaging 0.96
R1765:Cdan1 UTSW 2 120720749 missense probably damaging 1.00
R1806:Cdan1 UTSW 2 120731426 utr 3 prime probably benign
R1856:Cdan1 UTSW 2 120724936 missense probably benign
R2202:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2203:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R2204:Cdan1 UTSW 2 120720760 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120725632 missense probably damaging 1.00
R3957:Cdan1 UTSW 2 120731020 utr 3 prime probably benign
R4060:Cdan1 UTSW 2 120725743 missense probably benign 0.00
R4324:Cdan1 UTSW 2 120724979 missense probably damaging 0.97
R4379:Cdan1 UTSW 2 120726618 missense probably damaging 1.00
R4611:Cdan1 UTSW 2 120730720 missense probably damaging 0.96
R4695:Cdan1 UTSW 2 120728383 missense probably damaging 1.00
R4866:Cdan1 UTSW 2 120731447 utr 3 prime probably benign
R5183:Cdan1 UTSW 2 120729580 missense probably damaging 0.96
R5347:Cdan1 UTSW 2 120730065 missense possibly damaging 0.95
R5789:Cdan1 UTSW 2 120729535 missense probably benign 0.22
R5958:Cdan1 UTSW 2 120723902 missense possibly damaging 0.80
R6608:Cdan1 UTSW 2 120726680 missense possibly damaging 0.78
R7055:Cdan1 UTSW 2 120727861 missense probably damaging 0.97
R7065:Cdan1 UTSW 2 120718921 missense probably benign 0.00
R7225:Cdan1 UTSW 2 120724912 missense probably benign
R7238:Cdan1 UTSW 2 120730302 missense probably benign
R7316:Cdan1 UTSW 2 120728332 critical splice donor site probably null
R7325:Cdan1 UTSW 2 120724704 missense probably benign 0.25
R7432:Cdan1 UTSW 2 120722755 missense probably damaging 1.00
R7517:Cdan1 UTSW 2 120727924 missense probably damaging 1.00
R7691:Cdan1 UTSW 2 120729567 missense probably damaging 1.00
R8004:Cdan1 UTSW 2 120731443 missense unknown
R8465:Cdan1 UTSW 2 120728440 missense possibly damaging 0.93
R8556:Cdan1 UTSW 2 120722990 missense probably damaging 1.00
R8932:Cdan1 UTSW 2 120731087 nonsense probably null
R9462:Cdan1 UTSW 2 120729579 missense possibly damaging 0.87
R9718:Cdan1 UTSW 2 120724169 missense probably damaging 1.00
X0050:Cdan1 UTSW 2 120724145 missense probably benign 0.29
Z1088:Cdan1 UTSW 2 120730336 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGCCCGCCAAATTTGAAC -3'
(R):5'- TGGCCTGAAGATCTGAGAGG -3'

Sequencing Primer
(F):5'- ATGCCCGCCAAATTTGAACTATCTC -3'
(R):5'- CCTGAAGATCTGAGAGGGCATTTC -3'
Posted On 2020-09-02