Mutagenetix > Incidental Mutation

Incidental Mutation 'R7517:Hipk3'

582504

Institutional Source

Beutler Lab

Gene Symbol

Hipk3

Ensembl Gene

ENSMUSG00000027177

Gene Name

homeodomain interacting protein kinase 3

Synonyms

DYRK6, FIST3

MMRRC Submission

045590-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104426481-104494446 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104434714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 674 (T674A)

Ref Sequence

ENSEMBL: ENSMUSP00000028600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]

AlphaFold

Q9ERH7

Predicted Effect

probably benign
Transcript: ENSMUST00000028600
AA Change: T674A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: T674A

Domain	Start	End	E-Value	Type
S_TKc	197	525	1.58e-76	SMART
low complexity region	844	859	N/A	INTRINSIC
low complexity region	887	906	N/A	INTRINSIC
low complexity region	1093	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111124
AA Change: T674A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: T674A

Domain	Start	End	E-Value	Type
S_TKc	197	525	1.58e-76	SMART
low complexity region	844	859	N/A	INTRINSIC
low complexity region	887	906	N/A	INTRINSIC
low complexity region	1093	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111125
AA Change: T674A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: T674A

Domain	Start	End	E-Value	Type
S_TKc	197	525	1.58e-76	SMART
low complexity region	865	880	N/A	INTRINSIC
low complexity region	908	927	N/A	INTRINSIC
low complexity region	1114	1138	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Cacna2d4	C	T	6: 119,271,921	R448C	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Cdan1	C	T	2: 120,727,924	R469Q	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Gtf2ird1	T	C	5: 134,362,525	D899G	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Mpp7	G	A	18: 7,440,183	Q263*	probably null	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Tgm3	T	G	2: 130,041,764	S447R	probably benign	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Unc13b	C	A	4: 43,215,765	S21R	probably benign	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Hipk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00717:Hipk3	APN	2	104430231	missense	possibly damaging	0.52
IGL00937:Hipk3	APN	2	104433172	missense	possibly damaging	0.82
IGL01719:Hipk3	APN	2	104437089	missense	possibly damaging	0.78
IGL01802:Hipk3	APN	2	104471853	splice site	probably benign
IGL01932:Hipk3	APN	2	104470981	missense	probably damaging	1.00
IGL02089:Hipk3	APN	2	104431379	missense	probably damaging	1.00
IGL02522:Hipk3	APN	2	104471331	missense	probably damaging	1.00
IGL02525:Hipk3	APN	2	104471412	missense	probably damaging	1.00
IGL02959:Hipk3	APN	2	104471259	missense	probably damaging	1.00
IGL02986:Hipk3	APN	2	104433741	missense	probably damaging	1.00
R0136:Hipk3	UTSW	2	104439293	missense	probably benign	0.02
R0277:Hipk3	UTSW	2	104441248	missense	probably damaging	1.00
R0308:Hipk3	UTSW	2	104433207	missense	probably damaging	0.99
R0367:Hipk3	UTSW	2	104431249	nonsense	probably null
R0597:Hipk3	UTSW	2	104433637	missense	possibly damaging	0.94
R1079:Hipk3	UTSW	2	104471698	missense	probably benign	0.00
R1171:Hipk3	UTSW	2	104471676	missense	probably benign	0.02
R1244:Hipk3	UTSW	2	104433256	missense	probably damaging	1.00
R1509:Hipk3	UTSW	2	104441262	missense	probably benign	0.01
R1616:Hipk3	UTSW	2	104433745	nonsense	probably null
R1893:Hipk3	UTSW	2	104433256	missense	probably damaging	1.00
R1938:Hipk3	UTSW	2	104430188	missense	possibly damaging	0.89
R1969:Hipk3	UTSW	2	104433841	missense	probably damaging	1.00
R1975:Hipk3	UTSW	2	104471173	missense	probably benign	0.00
R1985:Hipk3	UTSW	2	104434435	missense	probably benign	0.16
R2105:Hipk3	UTSW	2	104439392	missense	probably damaging	0.97
R2422:Hipk3	UTSW	2	104471485	missense	probably benign	0.01
R3028:Hipk3	UTSW	2	104433790	missense	probably benign
R3747:Hipk3	UTSW	2	104441283	nonsense	probably null
R3923:Hipk3	UTSW	2	104470762	missense	probably damaging	1.00
R4320:Hipk3	UTSW	2	104446571	missense	probably damaging	1.00
R4321:Hipk3	UTSW	2	104446571	missense	probably damaging	1.00
R4322:Hipk3	UTSW	2	104446571	missense	probably damaging	1.00
R4323:Hipk3	UTSW	2	104446571	missense	probably damaging	1.00
R4324:Hipk3	UTSW	2	104446571	missense	probably damaging	1.00
R4595:Hipk3	UTSW	2	104441277	missense	probably benign	0.01
R4604:Hipk3	UTSW	2	104439329	missense	probably damaging	1.00
R4657:Hipk3	UTSW	2	104433759	missense	probably benign	0.00
R5193:Hipk3	UTSW	2	104430000	missense	possibly damaging	0.94
R5769:Hipk3	UTSW	2	104434953	missense	possibly damaging	0.69
R5843:Hipk3	UTSW	2	104440224	missense	possibly damaging	0.65
R5906:Hipk3	UTSW	2	104471808	missense	probably damaging	1.00
R5976:Hipk3	UTSW	2	104471184	missense	probably damaging	1.00
R5991:Hipk3	UTSW	2	104437983	missense	probably damaging	1.00
R6214:Hipk3	UTSW	2	104433741	missense	probably damaging	1.00
R6215:Hipk3	UTSW	2	104433741	missense	probably damaging	1.00
R6285:Hipk3	UTSW	2	104471425	missense	probably damaging	1.00
R6523:Hipk3	UTSW	2	104439408	missense	possibly damaging	0.50
R6713:Hipk3	UTSW	2	104446571	missense	probably damaging	1.00
R7381:Hipk3	UTSW	2	104439351	missense	probably damaging	0.99
R8780:Hipk3	UTSW	2	104433834	missense	probably damaging	0.99
R8843:Hipk3	UTSW	2	104437897	missense	probably benign	0.21
R9186:Hipk3	UTSW	2	104471094	missense	probably damaging	1.00
R9187:Hipk3	UTSW	2	104446591	missense	probably damaging	1.00
R9374:Hipk3	UTSW	2	104471505	missense	probably benign
R9398:Hipk3	UTSW	2	104433217	missense	probably benign	0.01
R9552:Hipk3	UTSW	2	104471505	missense	probably benign
R9584:Hipk3	UTSW	2	104471565	missense	probably benign	0.01
R9641:Hipk3	UTSW	2	104437031	missense	probably benign
X0021:Hipk3	UTSW	2	104441366	critical splice acceptor site	probably null
Z1088:Hipk3	UTSW	2	104434629	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCACCGAGTTGTAATGATTGC -3'
(R):5'- AGTCACATGTCAGCCGGTTC -3'

Sequencing Primer
(F):5'- GAATCTCCTTTTTACTGGGATCTG -3'
(R):5'- GAGGGTTCCGTCCTTTCT -3'

Posted On

2019-10-17