Incidental Mutation 'R7526:Ing3'
ID 582984
Institutional Source Beutler Lab
Gene Symbol Ing3
Ensembl Gene ENSMUSG00000029670
Gene Name inhibitor of growth family, member 3
Synonyms P47ING3, 1300013A07Rik
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 21949570-21976037 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21953798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 80 (V80I)
Ref Sequence ENSEMBL: ENSMUSP00000031680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031680] [ENSMUST00000115389] [ENSMUST00000136200] [ENSMUST00000149728] [ENSMUST00000151473] [ENSMUST00000152877]
AlphaFold Q8VEK6
Predicted Effect probably damaging
Transcript: ENSMUST00000031680
AA Change: V80I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031680
Gene: ENSMUSG00000029670
AA Change: V80I

DomainStartEndE-ValueType
Pfam:ING 3 104 2.7e-31 PFAM
low complexity region 214 239 N/A INTRINSIC
low complexity region 308 345 N/A INTRINSIC
PHD 365 410 4e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115389
AA Change: V80I

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111047
Gene: ENSMUSG00000029670
AA Change: V80I

DomainStartEndE-ValueType
Pfam:ING 2 104 1.5e-33 PFAM
low complexity region 203 228 N/A INTRINSIC
low complexity region 297 334 N/A INTRINSIC
PHD 354 399 6.39e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136200
SMART Domains Protein: ENSMUSP00000138656
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 41 1.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149728
AA Change: V65I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145391
Gene: ENSMUSG00000029670
AA Change: V65I

DomainStartEndE-ValueType
Pfam:ING 1 89 6.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151473
AA Change: V56I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120651
Gene: ENSMUSG00000029670
AA Change: V56I

DomainStartEndE-ValueType
Pfam:ING 2 80 1.9e-19 PFAM
low complexity region 190 215 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152877
AA Change: V80I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138244
Gene: ENSMUSG00000029670
AA Change: V80I

DomainStartEndE-ValueType
Pfam:ING 2 89 1.5e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,043,807 (GRCm39) F85I unknown Het
Ankrd22 A T 19: 34,126,765 (GRCm39) W22R possibly damaging Het
Aqr A T 2: 113,938,590 (GRCm39) H1287Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm39) E791G probably damaging Het
Bicd1 T G 6: 149,415,224 (GRCm39) S646A possibly damaging Het
Bmpr1b A T 3: 141,562,360 (GRCm39) Y276N probably damaging Het
Cadps2 T C 6: 23,496,850 (GRCm39) H465R probably damaging Het
Card11 A T 5: 140,899,184 (GRCm39) probably null Het
Ccdc9 A G 7: 16,016,325 (GRCm39) L139P probably damaging Het
Cdk5rap3 A T 11: 96,800,771 (GRCm39) M355K probably benign Het
Cnot2 A T 10: 116,342,985 (GRCm39) V116E probably benign Het
Defb48 A G 14: 63,215,280 (GRCm39) V32A possibly damaging Het
Dmkn A G 7: 30,477,076 (GRCm39) D460G possibly damaging Het
Dmxl2 A G 9: 54,308,241 (GRCm39) V2170A possibly damaging Het
Dnah1 A T 14: 31,009,833 (GRCm39) F1912I possibly damaging Het
Dok3 C T 13: 55,675,306 (GRCm39) V71I probably benign Het
Dzip3 A T 16: 48,795,837 (GRCm39) F178Y probably damaging Het
Enpp1 T C 10: 24,550,308 (GRCm39) probably null Het
Eogt A G 6: 97,090,913 (GRCm39) F409L probably damaging Het
Erich6 A T 3: 58,538,110 (GRCm39) L218H probably damaging Het
Fam186a G C 15: 99,839,796 (GRCm39) I2149M possibly damaging Het
Fat1 G A 8: 45,476,464 (GRCm39) V1837I probably damaging Het
Flrt3 T A 2: 140,502,126 (GRCm39) T501S probably damaging Het
Fmn1 A C 2: 113,518,479 (GRCm39) E1365D probably damaging Het
Fzd5 G T 1: 64,775,251 (GRCm39) P170Q probably benign Het
Gm14326 G A 2: 177,588,298 (GRCm39) H233Y probably damaging Het
Gm19410 G A 8: 36,257,766 (GRCm39) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,919 (GRCm39) I143L Het
Greb1 G A 12: 16,766,766 (GRCm39) T344I probably benign Het
Grik2 A T 10: 49,399,918 (GRCm39) Y271N possibly damaging Het
Grin3b A G 10: 79,808,885 (GRCm39) N212D probably benign Het
Hgsnat A G 8: 26,461,077 (GRCm39) L187P probably damaging Het
Hmcn1 A G 1: 150,532,324 (GRCm39) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,661,728 (GRCm39) I96N unknown Het
Il18r1 T A 1: 40,510,932 (GRCm39) L6I probably damaging Het
Kif18b T C 11: 102,805,493 (GRCm39) I255V probably damaging Het
Kif2c A T 4: 117,039,629 (GRCm39) N20K possibly damaging Het
Mfsd6l T C 11: 68,448,864 (GRCm39) W572R probably damaging Het
Mybphl A G 3: 108,281,496 (GRCm39) T71A probably benign Het
Myo7a G T 7: 97,734,655 (GRCm39) T613K possibly damaging Het
Nfatc3 T C 8: 106,805,715 (GRCm39) S195P probably damaging Het
Nrg1 T C 8: 32,308,351 (GRCm39) N603S probably benign Het
Or52ae9 T C 7: 103,389,607 (GRCm39) Y280C probably damaging Het
Or8k22 A T 2: 86,163,697 (GRCm39) M1K probably null Het
Or8k37 A G 2: 86,470,013 (GRCm39) I13T possibly damaging Het
Parp8 T C 13: 117,031,341 (GRCm39) E457G probably damaging Het
Pclo T C 5: 14,571,076 (GRCm39) F154L probably benign Het
Pear1 A G 3: 87,659,875 (GRCm39) S704P probably damaging Het
Pkib A G 10: 57,612,394 (GRCm39) T92A probably benign Het
Pnpla7 A G 2: 24,888,678 (GRCm39) R376G possibly damaging Het
Pramel28 A T 4: 143,692,387 (GRCm39) C205S probably benign Het
Ptprd T A 4: 75,984,564 (GRCm39) E527D probably benign Het
Pum1 T C 4: 130,474,337 (GRCm39) V469A probably damaging Het
Rnf148 G A 6: 23,654,283 (GRCm39) Q238* probably null Het
Scn9a A C 2: 66,313,990 (GRCm39) N1909K probably benign Het
Sema3c A T 5: 17,932,594 (GRCm39) H699L possibly damaging Het
Sema3f A T 9: 107,566,927 (GRCm39) C201S probably damaging Het
Serinc2 T A 4: 130,152,583 (GRCm39) D206V probably benign Het
Serping1 A T 2: 84,597,637 (GRCm39) S415T probably benign Het
Sirpb1b A T 3: 15,613,932 (GRCm39) L50Q probably damaging Het
Slc25a22 T C 7: 141,011,296 (GRCm39) E262G probably benign Het
Slc5a8 A G 10: 88,738,353 (GRCm39) I205M probably damaging Het
Sod2 G T 17: 13,226,918 (GRCm39) probably benign Het
Tec T C 5: 72,943,362 (GRCm39) I118V probably benign Het
Tenm3 A T 8: 48,740,847 (GRCm39) V1212E probably damaging Het
Tex44 G A 1: 86,354,237 (GRCm39) V49I probably benign Het
Tmem132d A T 5: 127,861,205 (GRCm39) L972* probably null Het
Tpte G A 8: 22,815,563 (GRCm39) probably null Het
Trim6 T A 7: 103,882,039 (GRCm39) I456N probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Ubxn8 A T 8: 34,123,635 (GRCm39) N101K probably benign Het
Vmn2r60 AG A 7: 41,845,158 (GRCm39) probably null Het
Vmn2r83 A G 10: 79,327,392 (GRCm39) T667A probably damaging Het
Zpld2 T C 4: 133,927,384 (GRCm39) probably null Het
Other mutations in Ing3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Ing3 APN 6 21,968,879 (GRCm39) splice site probably benign
IGL02330:Ing3 APN 6 21,952,120 (GRCm39) missense probably benign 0.00
IGL02668:Ing3 APN 6 21,950,058 (GRCm39) missense probably damaging 0.98
IGL02897:Ing3 APN 6 21,969,325 (GRCm39) missense probably benign 0.14
IGL03065:Ing3 APN 6 21,971,221 (GRCm39) missense probably benign
R0076:Ing3 UTSW 6 21,952,170 (GRCm39) missense probably benign
R0513:Ing3 UTSW 6 21,970,034 (GRCm39) missense probably damaging 0.98
R0711:Ing3 UTSW 6 21,971,236 (GRCm39) nonsense probably null
R2369:Ing3 UTSW 6 21,950,090 (GRCm39) missense probably damaging 0.98
R4660:Ing3 UTSW 6 21,973,710 (GRCm39) utr 3 prime probably benign
R4672:Ing3 UTSW 6 21,965,729 (GRCm39) splice site probably null
R5557:Ing3 UTSW 6 21,968,908 (GRCm39) missense possibly damaging 0.95
R5682:Ing3 UTSW 6 21,968,949 (GRCm39) missense probably damaging 0.98
R5773:Ing3 UTSW 6 21,971,834 (GRCm39) missense probably damaging 1.00
R5774:Ing3 UTSW 6 21,967,688 (GRCm39) missense probably benign
R5914:Ing3 UTSW 6 21,968,904 (GRCm39) missense probably benign 0.18
R5976:Ing3 UTSW 6 21,971,173 (GRCm39) missense probably benign 0.09
R6265:Ing3 UTSW 6 21,953,813 (GRCm39) missense probably damaging 0.99
R7239:Ing3 UTSW 6 21,952,193 (GRCm39) missense probably damaging 0.99
R8112:Ing3 UTSW 6 21,952,181 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACCTTGGAGGCTTGTTA -3'
(R):5'- ACAGTAGTCTTCACTGAGGTGTG -3'

Sequencing Primer
(F):5'- GGCTTGTTATTGCTAATATGATGAGC -3'
(R):5'- GAACGTCTATGACTCTTCCTCAAGG -3'
Posted On 2019-10-17