Incidental Mutation 'R7526:Dnah1'
ID 583020
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Name dynein, axonemal, heavy chain 1
Synonyms E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 045598-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7526 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 31260375-31323896 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31287876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1912 (F1912I)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048603
AA Change: F1912I

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: F1912I

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,152,981 (GRCm38) F85I unknown Het
Ankrd22 A T 19: 34,149,365 (GRCm38) W22R possibly damaging Het
Aqr A T 2: 114,108,109 (GRCm38) H1287Q probably damaging Het
Armh1 C A 4: 117,213,741 (GRCm38) A396S probably benign Het
Atp8b5 A G 4: 43,366,609 (GRCm38) E791G probably damaging Het
Bicd1 T G 6: 149,513,726 (GRCm38) S646A possibly damaging Het
Bmpr1b A T 3: 141,856,599 (GRCm38) Y276N probably damaging Het
Cadps2 T C 6: 23,496,851 (GRCm38) H465R probably damaging Het
Card11 A T 5: 140,913,429 (GRCm38) probably null Het
Ccdc9 A G 7: 16,282,400 (GRCm38) L139P probably damaging Het
Cdk5rap3 A T 11: 96,909,945 (GRCm38) M355K probably benign Het
Cnot2 A T 10: 116,507,080 (GRCm38) V116E probably benign Het
Defb48 A G 14: 62,977,831 (GRCm38) V32A possibly damaging Het
Dmkn A G 7: 30,777,651 (GRCm38) D460G possibly damaging Het
Dmxl2 A G 9: 54,400,957 (GRCm38) V2170A possibly damaging Het
Dok3 C T 13: 55,527,493 (GRCm38) V71I probably benign Het
Dzip3 A T 16: 48,975,474 (GRCm38) F178Y probably damaging Het
Enpp1 T C 10: 24,674,410 (GRCm38) probably null Het
Eogt A G 6: 97,113,952 (GRCm38) F409L probably damaging Het
Erich6 A T 3: 58,630,689 (GRCm38) L218H probably damaging Het
Fam186a G C 15: 99,941,915 (GRCm38) I2149M possibly damaging Het
Fat1 G A 8: 45,023,427 (GRCm38) V1837I probably damaging Het
Flrt3 T A 2: 140,660,206 (GRCm38) T501S probably damaging Het
Fmn1 A C 2: 113,688,134 (GRCm38) E1365D probably damaging Het
Fzd5 G T 1: 64,736,092 (GRCm38) P170Q probably benign Het
Gm13101 A T 4: 143,965,817 (GRCm38) C205S probably benign Het
Gm14326 G A 2: 177,946,505 (GRCm38) H233Y probably damaging Het
Gm19410 G A 8: 35,790,612 (GRCm38) V735M probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 (GRCm38) probably benign Het
Gm2832 A T 14: 41,280,962 (GRCm38) I143L Het
Gm7534 T C 4: 134,200,073 (GRCm38) probably null Het
Greb1 G A 12: 16,716,765 (GRCm38) T344I probably benign Het
Grik2 A T 10: 49,523,822 (GRCm38) Y271N possibly damaging Het
Grin3b A G 10: 79,973,051 (GRCm38) N212D probably benign Het
Hgsnat A G 8: 25,971,049 (GRCm38) L187P probably damaging Het
Hmcn1 A G 1: 150,656,573 (GRCm38) I3152T probably damaging Het
Hsp90aa1 A T 12: 110,695,294 (GRCm38) I96N unknown Het
Il18r1 T A 1: 40,471,772 (GRCm38) L6I probably damaging Het
Ing3 G A 6: 21,953,799 (GRCm38) V80I probably damaging Het
Kif18b T C 11: 102,914,667 (GRCm38) I255V probably damaging Het
Kif2c A T 4: 117,182,432 (GRCm38) N20K possibly damaging Het
Mfsd6l T C 11: 68,558,038 (GRCm38) W572R probably damaging Het
Mybphl A G 3: 108,374,180 (GRCm38) T71A probably benign Het
Myo7a G T 7: 98,085,448 (GRCm38) T613K possibly damaging Het
Nfatc3 T C 8: 106,079,083 (GRCm38) S195P probably damaging Het
Nrg1 T C 8: 31,818,323 (GRCm38) N603S probably benign Het
Olfr1054 A T 2: 86,333,353 (GRCm38) M1K probably null Het
Olfr1084 A G 2: 86,639,669 (GRCm38) I13T possibly damaging Het
Olfr629 T C 7: 103,740,400 (GRCm38) Y280C probably damaging Het
Parp8 T C 13: 116,894,805 (GRCm38) E457G probably damaging Het
Pclo T C 5: 14,521,062 (GRCm38) F154L probably benign Het
Pear1 A G 3: 87,752,568 (GRCm38) S704P probably damaging Het
Pkib A G 10: 57,736,298 (GRCm38) T92A probably benign Het
Pnpla7 A G 2: 24,998,666 (GRCm38) R376G possibly damaging Het
Ptprd T A 4: 76,066,327 (GRCm38) E527D probably benign Het
Pum1 T C 4: 130,747,026 (GRCm38) V469A probably damaging Het
Rnf148 G A 6: 23,654,284 (GRCm38) Q238* probably null Het
Scn9a A C 2: 66,483,646 (GRCm38) N1909K probably benign Het
Sema3c A T 5: 17,727,596 (GRCm38) H699L possibly damaging Het
Sema3f A T 9: 107,689,728 (GRCm38) C201S probably damaging Het
Serinc2 T A 4: 130,258,790 (GRCm38) D206V probably benign Het
Serping1 A T 2: 84,767,293 (GRCm38) S415T probably benign Het
Sirpb1b A T 3: 15,548,872 (GRCm38) L50Q probably damaging Het
Slc25a22 T C 7: 141,431,383 (GRCm38) E262G probably benign Het
Slc5a8 A G 10: 88,902,491 (GRCm38) I205M probably damaging Het
Sod2 G T 17: 13,008,031 (GRCm38) probably benign Het
Tec T C 5: 72,786,019 (GRCm38) I118V probably benign Het
Tenm3 A T 8: 48,287,812 (GRCm38) V1212E probably damaging Het
Tex44 G A 1: 86,426,515 (GRCm38) V49I probably benign Het
Tmem132d A T 5: 127,784,141 (GRCm38) L972* probably null Het
Tpte G A 8: 22,325,547 (GRCm38) probably null Het
Trim6 T A 7: 104,232,832 (GRCm38) I456N probably damaging Het
Ubr4 G C 4: 139,422,417 (GRCm38) V520L probably benign Het
Ubxn8 A T 8: 33,633,607 (GRCm38) N101K probably benign Het
Vmn2r60 AG A 7: 42,195,734 (GRCm38) probably null Het
Vmn2r83 A G 10: 79,491,558 (GRCm38) T667A probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31,287,873 (GRCm38) missense probably benign 0.01
IGL00227:Dnah1 APN 14 31,286,896 (GRCm38) missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31,261,839 (GRCm38) missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31,300,063 (GRCm38) missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31,300,809 (GRCm38) nonsense probably null
IGL00911:Dnah1 APN 14 31,304,434 (GRCm38) splice site probably null
IGL00949:Dnah1 APN 14 31,307,090 (GRCm38) missense probably benign 0.00
IGL00976:Dnah1 APN 14 31,278,138 (GRCm38) missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31,299,940 (GRCm38) missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31,292,320 (GRCm38) missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31,263,378 (GRCm38) missense probably benign 0.34
IGL01893:Dnah1 APN 14 31,266,470 (GRCm38) missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31,310,915 (GRCm38) missense probably benign 0.40
IGL01938:Dnah1 APN 14 31,283,887 (GRCm38) missense probably benign
IGL02032:Dnah1 APN 14 31,274,369 (GRCm38) missense probably benign
IGL02052:Dnah1 APN 14 31,268,786 (GRCm38) missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31,305,001 (GRCm38) missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31,304,928 (GRCm38) missense probably benign 0.00
IGL02143:Dnah1 APN 14 31,283,289 (GRCm38) missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31,300,967 (GRCm38) missense probably benign 0.00
IGL02442:Dnah1 APN 14 31,287,878 (GRCm38) missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31,305,833 (GRCm38) missense probably benign 0.05
IGL02558:Dnah1 APN 14 31,274,379 (GRCm38) missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31,284,815 (GRCm38) missense probably benign 0.05
IGL02720:Dnah1 APN 14 31,262,220 (GRCm38) missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31,283,998 (GRCm38) missense probably benign 0.44
IGL02738:Dnah1 APN 14 31,292,640 (GRCm38) missense probably benign 0.27
IGL02863:Dnah1 APN 14 31,295,293 (GRCm38) missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31,300,871 (GRCm38) missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31,266,717 (GRCm38) missense probably benign 0.40
IGL03201:Dnah1 APN 14 31,300,949 (GRCm38) missense probably benign 0.13
IGL03215:Dnah1 APN 14 31,274,391 (GRCm38) missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31,270,066 (GRCm38) missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31,269,889 (GRCm38) missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31,286,588 (GRCm38) missense probably benign 0.00
IGL03299:Dnah1 APN 14 31,315,122 (GRCm38) nonsense probably null
IGL03301:Dnah1 APN 14 31,292,692 (GRCm38) missense probably damaging 1.00
ergonomic UTSW 14 31,300,748 (GRCm38) missense possibly damaging 0.91
Faraday UTSW 14 31,310,882 (GRCm38) missense probably null 0.05
K3955:Dnah1 UTSW 14 31,266,459 (GRCm38) missense probably benign
PIT1430001:Dnah1 UTSW 14 31,262,580 (GRCm38) missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31,284,455 (GRCm38) missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31,274,405 (GRCm38) missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31,271,609 (GRCm38) missense probably benign 0.00
R0100:Dnah1 UTSW 14 31,262,152 (GRCm38) critical splice donor site probably null
R0100:Dnah1 UTSW 14 31,262,152 (GRCm38) critical splice donor site probably null
R0101:Dnah1 UTSW 14 31,283,899 (GRCm38) missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31,276,158 (GRCm38) missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31,276,158 (GRCm38) missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31,267,874 (GRCm38) splice site probably benign
R0279:Dnah1 UTSW 14 31,302,375 (GRCm38) missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31,276,158 (GRCm38) missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31,278,151 (GRCm38) missense probably benign 0.00
R0739:Dnah1 UTSW 14 31,265,915 (GRCm38) nonsense probably null
R0789:Dnah1 UTSW 14 31,304,591 (GRCm38) missense probably benign
R0826:Dnah1 UTSW 14 31,303,907 (GRCm38) missense probably benign 0.02
R1102:Dnah1 UTSW 14 31,296,457 (GRCm38) nonsense probably null
R1116:Dnah1 UTSW 14 31,307,867 (GRCm38) missense probably benign 0.13
R1229:Dnah1 UTSW 14 31,310,851 (GRCm38) missense probably benign 0.11
R1447:Dnah1 UTSW 14 31,306,898 (GRCm38) missense probably benign 0.06
R1449:Dnah1 UTSW 14 31,263,951 (GRCm38) missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31,268,781 (GRCm38) splice site probably benign
R1482:Dnah1 UTSW 14 31,294,874 (GRCm38) missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31,316,758 (GRCm38) missense probably benign
R1512:Dnah1 UTSW 14 31,293,037 (GRCm38) missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31,272,332 (GRCm38) missense probably benign 0.01
R1598:Dnah1 UTSW 14 31,301,262 (GRCm38) missense probably benign 0.07
R1644:Dnah1 UTSW 14 31,302,292 (GRCm38) splice site probably benign
R1672:Dnah1 UTSW 14 31,276,200 (GRCm38) missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31,279,182 (GRCm38) missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31,310,882 (GRCm38) missense probably null 0.05
R1796:Dnah1 UTSW 14 31,261,093 (GRCm38) missense probably benign 0.00
R1902:Dnah1 UTSW 14 31,319,759 (GRCm38) missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31,319,759 (GRCm38) missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31,264,630 (GRCm38) missense probably benign 0.06
R1908:Dnah1 UTSW 14 31,262,558 (GRCm38) missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31,265,391 (GRCm38) nonsense probably null
R1973:Dnah1 UTSW 14 31,265,391 (GRCm38) nonsense probably null
R2004:Dnah1 UTSW 14 31,301,856 (GRCm38) missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31,279,123 (GRCm38) missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31,271,129 (GRCm38) missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31,279,164 (GRCm38) missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31,299,974 (GRCm38) missense probably benign 0.00
R2862:Dnah1 UTSW 14 31,284,762 (GRCm38) missense probably benign 0.21
R2894:Dnah1 UTSW 14 31,298,761 (GRCm38) missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31,266,822 (GRCm38) nonsense probably null
R3410:Dnah1 UTSW 14 31,269,817 (GRCm38) missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31,269,817 (GRCm38) missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31,316,674 (GRCm38) missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31,315,148 (GRCm38) missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31,315,148 (GRCm38) missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31,265,467 (GRCm38) splice site probably benign
R3805:Dnah1 UTSW 14 31,294,763 (GRCm38) missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31,307,028 (GRCm38) missense probably benign
R4007:Dnah1 UTSW 14 31,303,784 (GRCm38) splice site probably benign
R4201:Dnah1 UTSW 14 31,262,270 (GRCm38) missense probably benign 0.00
R4232:Dnah1 UTSW 14 31,304,916 (GRCm38) missense probably benign
R4372:Dnah1 UTSW 14 31,304,922 (GRCm38) missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31,294,835 (GRCm38) missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31,284,761 (GRCm38) missense probably benign 0.00
R4526:Dnah1 UTSW 14 31,285,998 (GRCm38) missense probably benign 0.05
R4650:Dnah1 UTSW 14 31,284,887 (GRCm38) splice site probably null
R4723:Dnah1 UTSW 14 31,272,942 (GRCm38) missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31,319,945 (GRCm38) missense probably benign
R4783:Dnah1 UTSW 14 31,263,479 (GRCm38) missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31,263,479 (GRCm38) missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31,263,479 (GRCm38) missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31,264,963 (GRCm38) missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31,300,748 (GRCm38) missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31,267,539 (GRCm38) missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31,295,323 (GRCm38) missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31,286,898 (GRCm38) missense probably null 1.00
R5070:Dnah1 UTSW 14 31,282,418 (GRCm38) missense probably benign 0.05
R5128:Dnah1 UTSW 14 31,296,195 (GRCm38) splice site probably null
R5409:Dnah1 UTSW 14 31,263,255 (GRCm38) missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31,316,747 (GRCm38) missense probably benign
R5481:Dnah1 UTSW 14 31,308,871 (GRCm38) missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31,316,708 (GRCm38) missense probably benign 0.00
R5555:Dnah1 UTSW 14 31,290,819 (GRCm38) missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31,274,366 (GRCm38) missense probably benign 0.35
R5623:Dnah1 UTSW 14 31,286,023 (GRCm38) missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31,274,044 (GRCm38) missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31,310,906 (GRCm38) missense probably benign 0.00
R5823:Dnah1 UTSW 14 31,266,418 (GRCm38) missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31,268,027 (GRCm38) missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31,268,027 (GRCm38) missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31,269,425 (GRCm38) missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31,286,027 (GRCm38) missense probably benign 0.02
R6145:Dnah1 UTSW 14 31,300,970 (GRCm38) missense probably benign 0.07
R6306:Dnah1 UTSW 14 31,304,587 (GRCm38) missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31,275,608 (GRCm38) missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31,300,808 (GRCm38) missense probably benign 0.08
R6549:Dnah1 UTSW 14 31,269,383 (GRCm38) missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31,299,988 (GRCm38) missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31,286,290 (GRCm38) missense probably benign 0.00
R6870:Dnah1 UTSW 14 31,271,061 (GRCm38) nonsense probably null
R6932:Dnah1 UTSW 14 31,287,776 (GRCm38) missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31,268,904 (GRCm38) missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31,264,925 (GRCm38) missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31,297,110 (GRCm38) missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31,286,076 (GRCm38) missense probably benign
R7136:Dnah1 UTSW 14 31,298,656 (GRCm38) missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31,274,382 (GRCm38) missense probably benign
R7241:Dnah1 UTSW 14 31,264,939 (GRCm38) missense probably benign 0.00
R7260:Dnah1 UTSW 14 31,269,386 (GRCm38) missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31,269,894 (GRCm38) missense probably benign
R7291:Dnah1 UTSW 14 31,298,705 (GRCm38) missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31,287,863 (GRCm38) missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31,269,841 (GRCm38) missense probably benign 0.05
R7319:Dnah1 UTSW 14 31,296,594 (GRCm38) missense probably benign 0.02
R7323:Dnah1 UTSW 14 31,298,707 (GRCm38) missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31,300,791 (GRCm38) missense possibly damaging 0.80
R7472:Dnah1 UTSW 14 31,261,590 (GRCm38) missense probably damaging 1.00
R7499:Dnah1 UTSW 14 31,315,122 (GRCm38) nonsense probably null
R7560:Dnah1 UTSW 14 31,304,983 (GRCm38) missense probably benign
R7574:Dnah1 UTSW 14 31,319,908 (GRCm38) missense probably benign 0.00
R7617:Dnah1 UTSW 14 31,284,782 (GRCm38) missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31,303,906 (GRCm38) missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31,292,338 (GRCm38) missense probably benign 0.00
R7702:Dnah1 UTSW 14 31,310,909 (GRCm38) missense probably benign
R7786:Dnah1 UTSW 14 31,262,521 (GRCm38) missense probably damaging 1.00
R7984:Dnah1 UTSW 14 31,267,815 (GRCm38) missense probably damaging 1.00
R8002:Dnah1 UTSW 14 31,298,722 (GRCm38) missense probably damaging 1.00
R8022:Dnah1 UTSW 14 31,265,014 (GRCm38) missense probably damaging 1.00
R8032:Dnah1 UTSW 14 31,271,548 (GRCm38) missense probably damaging 1.00
R8099:Dnah1 UTSW 14 31,302,364 (GRCm38) missense probably benign 0.00
R8171:Dnah1 UTSW 14 31,297,110 (GRCm38) missense probably damaging 1.00
R8263:Dnah1 UTSW 14 31,293,177 (GRCm38) missense probably damaging 1.00
R8274:Dnah1 UTSW 14 31,295,574 (GRCm38) missense probably benign 0.00
R8345:Dnah1 UTSW 14 31,264,594 (GRCm38) missense probably damaging 1.00
R8348:Dnah1 UTSW 14 31,293,725 (GRCm38) missense probably damaging 1.00
R8353:Dnah1 UTSW 14 31,283,202 (GRCm38) missense probably benign
R8356:Dnah1 UTSW 14 31,273,015 (GRCm38) missense probably benign 0.00
R8376:Dnah1 UTSW 14 31,301,346 (GRCm38) missense probably damaging 1.00
R8448:Dnah1 UTSW 14 31,293,725 (GRCm38) missense probably damaging 1.00
R8461:Dnah1 UTSW 14 31,305,958 (GRCm38) missense probably benign 0.00
R8534:Dnah1 UTSW 14 31,301,848 (GRCm38) missense probably benign 0.16
R8544:Dnah1 UTSW 14 31,268,904 (GRCm38) missense probably damaging 1.00
R8679:Dnah1 UTSW 14 31,267,810 (GRCm38) missense possibly damaging 0.77
R8716:Dnah1 UTSW 14 31,267,984 (GRCm38) critical splice donor site probably benign
R8750:Dnah1 UTSW 14 31,304,967 (GRCm38) missense probably benign 0.30
R8790:Dnah1 UTSW 14 31,296,275 (GRCm38) missense possibly damaging 0.89
R8808:Dnah1 UTSW 14 31,286,814 (GRCm38) missense probably benign
R8821:Dnah1 UTSW 14 31,296,498 (GRCm38) missense probably benign
R8887:Dnah1 UTSW 14 31,311,040 (GRCm38) missense probably damaging 1.00
R8948:Dnah1 UTSW 14 31,290,439 (GRCm38) missense probably damaging 1.00
R8950:Dnah1 UTSW 14 31,290,439 (GRCm38) missense probably damaging 1.00
R8955:Dnah1 UTSW 14 31,285,993 (GRCm38) missense probably benign
R8987:Dnah1 UTSW 14 31,311,747 (GRCm38) missense possibly damaging 0.93
R8998:Dnah1 UTSW 14 31,296,278 (GRCm38) missense probably benign 0.12
R8999:Dnah1 UTSW 14 31,296,278 (GRCm38) missense probably benign 0.12
R9015:Dnah1 UTSW 14 31,264,359 (GRCm38) missense probably damaging 0.96
R9031:Dnah1 UTSW 14 31,279,171 (GRCm38) missense probably benign
R9088:Dnah1 UTSW 14 31,266,013 (GRCm38) missense probably benign 0.04
R9096:Dnah1 UTSW 14 31,261,070 (GRCm38) missense probably damaging 0.99
R9117:Dnah1 UTSW 14 31,311,624 (GRCm38) splice site probably benign
R9157:Dnah1 UTSW 14 31,266,013 (GRCm38) missense probably damaging 0.97
R9296:Dnah1 UTSW 14 31,274,054 (GRCm38) critical splice acceptor site probably null
R9313:Dnah1 UTSW 14 31,266,013 (GRCm38) missense probably damaging 0.97
R9325:Dnah1 UTSW 14 31,276,203 (GRCm38) missense possibly damaging 0.69
R9352:Dnah1 UTSW 14 31,316,663 (GRCm38) missense probably benign 0.00
R9411:Dnah1 UTSW 14 31,296,299 (GRCm38) missense probably damaging 1.00
R9429:Dnah1 UTSW 14 31,275,542 (GRCm38) nonsense probably null
R9452:Dnah1 UTSW 14 31,296,491 (GRCm38) missense probably benign 0.35
R9562:Dnah1 UTSW 14 31,264,437 (GRCm38) missense probably damaging 1.00
R9565:Dnah1 UTSW 14 31,264,437 (GRCm38) missense probably damaging 1.00
R9616:Dnah1 UTSW 14 31,304,443 (GRCm38) missense probably null 0.20
R9621:Dnah1 UTSW 14 31,294,815 (GRCm38) missense probably damaging 1.00
R9677:Dnah1 UTSW 14 31,307,864 (GRCm38) missense probably benign 0.00
R9723:Dnah1 UTSW 14 31,265,989 (GRCm38) missense probably damaging 1.00
R9758:Dnah1 UTSW 14 31,263,438 (GRCm38) missense probably damaging 0.98
RF006:Dnah1 UTSW 14 31,307,875 (GRCm38) missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31,304,811 (GRCm38) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGGACGTGGCTCCAAGAAG -3'
(R):5'- GACCAATACTTCTGTATCTGTTTGG -3'

Sequencing Primer
(F):5'- ATGGCGCAGACTCCAGAG -3'
(R):5'- CTGTTTGGTAACCACTCAAAAACTG -3'
Posted On 2019-10-17