Incidental Mutation 'R7645:Dennd1a'
List |< first << previous [record 11 of 48] next >> last >|
ID590466
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene NameDENN/MADD domain containing 1A
Synonyms6030446I19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37798991-38287390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38021363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 204 (L204P)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000130472] [ENSMUST00000140552] [ENSMUST00000150896]
Predicted Effect probably damaging
Transcript: ENSMUST00000102787
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: L204P

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130472
SMART Domains Protein: ENSMUSP00000119892
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
Blast:uDENN 9 64 4e-20 BLAST
PDB:3TW8|C 44 105 3e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Predicted Effect probably benign
Transcript: ENSMUST00000150896
SMART Domains Protein: ENSMUSP00000116723
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38243442 nonsense probably null
IGL00490:Dennd1a APN 2 37801152 missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37816982 missense probably benign 0.30
IGL01065:Dennd1a APN 2 37844905 missense probably benign 0.02
IGL01621:Dennd1a APN 2 37844809 missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38126580 missense probably damaging 1.00
IGL01799:Dennd1a APN 2 38048742 missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37852394 critical splice donor site probably null
contract UTSW 2 37852441 missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38126640 missense probably damaging 0.96
R0784:Dennd1a UTSW 2 38021414 missense probably damaging 1.00
R1199:Dennd1a UTSW 2 37961716 missense probably damaging 0.99
R1439:Dennd1a UTSW 2 38043400 missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37858429 missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37852434 missense probably benign 0.18
R1720:Dennd1a UTSW 2 37800197 nonsense probably null
R1967:Dennd1a UTSW 2 37844833 missense probably benign
R2570:Dennd1a UTSW 2 37844783 missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37858077 missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38243390 splice site probably benign
R4890:Dennd1a UTSW 2 38176226 intron probably benign
R5395:Dennd1a UTSW 2 37802128 missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37801126 missense probably benign 0.00
R5882:Dennd1a UTSW 2 37961663 missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37852441 missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37961747 splice site probably null
R6934:Dennd1a UTSW 2 37801213 missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37961654 missense probably damaging 1.00
R7109:Dennd1a UTSW 2 38048792 missense probably damaging 1.00
R7204:Dennd1a UTSW 2 38039203 missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37801061 missense probably benign
R7408:Dennd1a UTSW 2 37852172 splice site probably null
R7446:Dennd1a UTSW 2 37816979 missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37858432 missense probably damaging 0.99
R7661:Dennd1a UTSW 2 37844829 missense probably benign
R8132:Dennd1a UTSW 2 37858060 missense probably damaging 1.00
R8305:Dennd1a UTSW 2 37858081 missense probably damaging 1.00
R8369:Dennd1a UTSW 2 38048754 missense probably damaging 1.00
R8418:Dennd1a UTSW 2 37858391 missense probably benign 0.36
R8438:Dennd1a UTSW 2 37856138 missense probably benign 0.08
Z1088:Dennd1a UTSW 2 37800692 missense probably benign
Z1177:Dennd1a UTSW 2 37800257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTTGACACTGTAAAGGG -3'
(R):5'- TTCCAGGTAGAAAGTGTGGGAC -3'

Sequencing Primer
(F):5'- CTTTGACACTGTAAAGGGACATG -3'
(R):5'- AGAAGAGCACATGCCTTCTG -3'
Posted On2019-10-24