Incidental Mutation 'R7674:Mpeg1'
ID592402
Institutional Source Beutler Lab
Gene Symbol Mpeg1
Ensembl Gene ENSMUSG00000046805
Gene Namemacrophage expressed gene 1
SynonymsMPS1, Mpg-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12460779-12465284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12461387 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 70 (M70L)
Ref Sequence ENSEMBL: ENSMUSP00000108573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]
Predicted Effect probably benign
Transcript: ENSMUST00000045521
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000081035
AA Change: M70L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805
AA Change: M70L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MACPF 151 350 2.13e-58 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 685 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Mpeg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mpeg1 APN 19 12462710 missense probably benign 0.39
IGL00902:Mpeg1 APN 19 12461769 missense probably damaging 1.00
IGL01141:Mpeg1 APN 19 12462785 missense probably damaging 1.00
IGL02037:Mpeg1 APN 19 12463296 missense probably benign 0.04
IGL02447:Mpeg1 APN 19 12462792 missense probably damaging 1.00
IGL02448:Mpeg1 APN 19 12462609 missense probably benign
IGL02510:Mpeg1 APN 19 12461424 missense probably damaging 1.00
IGL03068:Mpeg1 APN 19 12462206 missense probably benign 0.01
R0128:Mpeg1 UTSW 19 12461223 missense probably benign 0.00
R0310:Mpeg1 UTSW 19 12461691 missense probably benign 0.00
R0312:Mpeg1 UTSW 19 12462403 missense probably damaging 1.00
R0522:Mpeg1 UTSW 19 12461759 missense probably damaging 0.99
R1356:Mpeg1 UTSW 19 12461325 missense probably damaging 0.98
R1396:Mpeg1 UTSW 19 12462804 missense probably damaging 1.00
R1436:Mpeg1 UTSW 19 12462459 missense probably damaging 0.98
R1497:Mpeg1 UTSW 19 12461247 missense probably benign 0.04
R1714:Mpeg1 UTSW 19 12462834 missense probably damaging 1.00
R1846:Mpeg1 UTSW 19 12463122 missense probably benign 0.00
R1856:Mpeg1 UTSW 19 12462356 missense probably benign 0.04
R1933:Mpeg1 UTSW 19 12462647 nonsense probably null
R1959:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1960:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1961:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R2240:Mpeg1 UTSW 19 12463038 missense probably damaging 0.98
R2474:Mpeg1 UTSW 19 12462249 missense probably damaging 1.00
R3430:Mpeg1 UTSW 19 12463128 missense probably benign 0.22
R4079:Mpeg1 UTSW 19 12462270 missense probably damaging 0.99
R4245:Mpeg1 UTSW 19 12462908 missense probably damaging 0.99
R4451:Mpeg1 UTSW 19 12463232 nonsense probably null
R4888:Mpeg1 UTSW 19 12463070 missense probably damaging 1.00
R4980:Mpeg1 UTSW 19 12461540 missense probably damaging 1.00
R5071:Mpeg1 UTSW 19 12461181 start codon destroyed probably null 0.02
R5089:Mpeg1 UTSW 19 12462997 missense probably benign 0.00
R5120:Mpeg1 UTSW 19 12461429 nonsense probably null
R5327:Mpeg1 UTSW 19 12461649 missense probably damaging 1.00
R5490:Mpeg1 UTSW 19 12461693 missense probably damaging 0.99
R5725:Mpeg1 UTSW 19 12462636 missense probably benign 0.13
R6147:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R6243:Mpeg1 UTSW 19 12462240 missense probably benign 0.26
R6486:Mpeg1 UTSW 19 12462105 missense probably damaging 1.00
R6520:Mpeg1 UTSW 19 12461958 missense probably benign 0.04
R7139:Mpeg1 UTSW 19 12461714 missense probably benign 0.07
R7204:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R7310:Mpeg1 UTSW 19 12462251 missense probably damaging 0.99
R7665:Mpeg1 UTSW 19 12463094 missense probably damaging 1.00
R8388:Mpeg1 UTSW 19 12462914 missense probably damaging 1.00
R8749:Mpeg1 UTSW 19 12461927 missense probably benign 0.08
R8755:Mpeg1 UTSW 19 12461874 missense probably damaging 0.98
R8773:Mpeg1 UTSW 19 12463055 missense probably damaging 1.00
R8808:Mpeg1 UTSW 19 12463079 missense probably damaging 1.00
X0064:Mpeg1 UTSW 19 12461972 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCATCTGCGCCATGAACAG -3'
(R):5'- AGAACTTGCCGTTGACTCTGG -3'

Sequencing Primer
(F):5'- ATGAACAGCTTCATGGCCTTG -3'
(R):5'- CTTGCCGTTGACTCTGGAGAAAAG -3'
Posted On2019-11-12