Incidental Mutation 'R7674:Olfr1024'
ID592354
Institutional Source Beutler Lab
Gene Symbol Olfr1024
Ensembl Gene ENSMUSG00000075206
Gene Nameolfactory receptor 1024
SynonymsGA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85904069-85905052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85904536 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 173 (F173V)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
Predicted Effect probably damaging
Transcript: ENSMUST00000099912
AA Change: F173V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: F173V

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Olfr1024
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Olfr1024 APN 2 85904370 missense probably benign
IGL02108:Olfr1024 APN 2 85904150 missense possibly damaging 0.67
IGL02738:Olfr1024 APN 2 85904949 missense probably benign 0.06
IGL03343:Olfr1024 APN 2 85904941 missense probably benign
IGL02802:Olfr1024 UTSW 2 85904389 missense probably damaging 1.00
R0265:Olfr1024 UTSW 2 85904247 missense probably benign 0.01
R0271:Olfr1024 UTSW 2 85904289 missense possibly damaging 0.68
R0432:Olfr1024 UTSW 2 85904157 missense probably damaging 1.00
R0501:Olfr1024 UTSW 2 85905004 missense probably damaging 1.00
R0504:Olfr1024 UTSW 2 85904686 missense possibly damaging 0.95
R1513:Olfr1024 UTSW 2 85904671 missense probably damaging 1.00
R2224:Olfr1024 UTSW 2 85904755 missense probably benign 0.11
R2516:Olfr1024 UTSW 2 85904556 missense probably benign 0.01
R3845:Olfr1024 UTSW 2 85904737 missense probably damaging 0.99
R4871:Olfr1024 UTSW 2 85904371 missense probably benign
R4889:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R4890:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R5543:Olfr1024 UTSW 2 85904328 missense probably damaging 1.00
R5865:Olfr1024 UTSW 2 85904521 missense probably benign 0.00
R6254:Olfr1024 UTSW 2 85904505 missense probably damaging 1.00
R6331:Olfr1024 UTSW 2 85904216 missense probably benign 0.32
R6465:Olfr1024 UTSW 2 85904539 missense probably benign 0.05
R7183:Olfr1024 UTSW 2 85904142 missense probably benign 0.00
R7427:Olfr1024 UTSW 2 85904131 nonsense probably null
R7428:Olfr1024 UTSW 2 85904131 nonsense probably null
R7552:Olfr1024 UTSW 2 85904103 missense probably benign 0.01
R7654:Olfr1024 UTSW 2 85904319 missense possibly damaging 0.95
R7980:Olfr1024 UTSW 2 85904598 missense probably benign 0.22
R8209:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
R8226:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
Z1177:Olfr1024 UTSW 2 85905045 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTTGCCCTTCACTGGAAC -3'
(R):5'- CATTGGGTGTCTGACTCAGTGC -3'

Sequencing Primer
(F):5'- AACGGATCCTCATGATGGTG -3'
(R):5'- GCTGTTAACTGAATATTACATGCTGG -3'
Posted On2019-11-12