Incidental Mutation 'RF010:Mapk9'
ID603142
Institutional Source Beutler Lab
Gene Symbol Mapk9
Ensembl Gene ENSMUSG00000020366
Gene Namemitogen-activated protein kinase 9
SynonymsJNK2, JNK/SAPK alpha, Prkm9
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49846751-49886421 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 49854256 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020634] [ENSMUST00000043321] [ENSMUST00000102778] [ENSMUST00000109178] [ENSMUST00000109179] [ENSMUST00000164643] [ENSMUST00000178543]
Predicted Effect probably benign
Transcript: ENSMUST00000020634
SMART Domains Protein: ENSMUSP00000020634
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043321
SMART Domains Protein: ENSMUSP00000042744
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102778
SMART Domains Protein: ENSMUSP00000099839
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109178
SMART Domains Protein: ENSMUSP00000104807
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109179
SMART Domains Protein: ENSMUSP00000104808
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164643
SMART Domains Protein: ENSMUSP00000132864
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178543
SMART Domains Protein: ENSMUSP00000136977
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a null allele show resistance to TNF-induced liver injury, impaired TH1 cell differentiation, and enhanced epidermal differentiation and proliferation. Homozygotes for a reporter allele show impaired T-cell activation and apoptosis, resistance to I-R cardiac injury, and reduced LTP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Mapk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Mapk9 APN 11 49867038 missense probably damaging 1.00
IGL03399:Mapk9 APN 11 49883299 utr 3 prime probably benign
Infirm UTSW 11 49863556 missense probably damaging 1.00
R0003:Mapk9 UTSW 11 49867039 missense possibly damaging 0.52
R0610:Mapk9 UTSW 11 49863573 missense probably benign 0.00
R0676:Mapk9 UTSW 11 49883156 makesense probably null
R0681:Mapk9 UTSW 11 49869245 missense probably damaging 1.00
R0736:Mapk9 UTSW 11 49883254 missense possibly damaging 0.58
R1186:Mapk9 UTSW 11 49878269 missense probably damaging 0.99
R1964:Mapk9 UTSW 11 49854333 missense probably null 1.00
R2424:Mapk9 UTSW 11 49863672 missense probably damaging 1.00
R4876:Mapk9 UTSW 11 49854325 missense probably damaging 0.97
R6191:Mapk9 UTSW 11 49863556 missense probably damaging 1.00
R7059:Mapk9 UTSW 11 49867047 splice site probably null
R7484:Mapk9 UTSW 11 49872836 missense probably damaging 0.97
R7951:Mapk9 UTSW 11 49863595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTTGCTTAAATGGAGAGCG -3'
(R):5'- CAGTGCTACTAAAGTCTTACTCAGTAG -3'

Sequencing Primer
(F):5'- AGCGTGGCCAAGCTGATTTAC -3'
(R):5'- GTTTCACTTTTTACTAAAGGCTTCG -3'
Posted On2019-12-04