Incidental Mutation 'R7873:Vmn2r45'
ID608246
Institutional Source Beutler Lab
Gene Symbol Vmn2r45
Ensembl Gene ENSMUSG00000090662
Gene Namevomeronasal 2, receptor 45
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7873 (G1)
Quality Score190.009
Status Not validated
Chromosome7
Chromosomal Location8470525-8489075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8483075 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 405 (I405L)
Ref Sequence ENSEMBL: ENSMUSP00000129466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164845]
Predicted Effect probably benign
Transcript: ENSMUST00000164845
AA Change: I405L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: I405L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 469 4.5e-26 PFAM
Pfam:NCD3G 512 565 6.4e-21 PFAM
Pfam:7tm_3 598 833 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,866,227 I229F probably benign Het
Abca14 T C 7: 120,289,569 L1246S probably benign Het
Acacb A C 5: 114,223,278 S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 S585T possibly damaging Het
Btbd11 T C 10: 85,631,125 V685A possibly damaging Het
Ccdc54 A G 16: 50,590,309 V198A probably benign Het
Cnga4 A G 7: 105,407,042 I387V probably damaging Het
Creg1 G T 1: 165,769,879 D141Y probably damaging Het
Cxcr2 T C 1: 74,159,007 L220P probably benign Het
Dennd5a T A 7: 109,926,934 I344F probably damaging Het
Dysf A G 6: 84,083,765 N448S probably benign Het
Efcab6 A G 15: 84,018,625 probably null Het
Elf2 C A 3: 51,256,678 V489F probably damaging Het
Elmod2 G T 8: 83,331,219 H12N probably benign Het
Eln C T 5: 134,711,187 G618E unknown Het
Fam129c A T 8: 71,602,248 I193F probably damaging Het
Fbxo33 G T 12: 59,219,021 S153R possibly damaging Het
Fbxw7 A T 3: 84,925,764 I38F possibly damaging Het
Flnc G A 6: 29,456,991 V2329I possibly damaging Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm16486 A G 8: 70,711,340 M1061V probably benign Het
Gm5724 T A 6: 141,727,722 L363F probably benign Het
Gpr155 T C 2: 73,343,590 E825G possibly damaging Het
Grk3 A T 5: 112,929,686 M405K probably benign Het
Hace1 T C 10: 45,672,787 V597A possibly damaging Het
Hist1h2bf A T 13: 23,574,070 Y41N probably damaging Het
Ido1 A G 8: 24,584,742 F295S probably damaging Het
Ighe T A 12: 113,271,322 E406V Het
Ighv1-31 G T 12: 114,829,654 A15E probably benign Het
Ighv1-75 A T 12: 115,834,368 L10H probably damaging Het
Inpp5e T A 2: 26,407,945 K215* probably null Het
Krt18 C T 15: 102,030,956 T288I probably benign Het
Lrwd1 A T 5: 136,123,938 I490N probably benign Het
Macf1 T A 4: 123,504,551 probably null Het
Mapk8ip3 A G 17: 24,906,172 V482A probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdk A G 2: 91,931,428 F7S probably benign Het
Mycbp2 G A 14: 103,156,146 P2993L probably damaging Het
Nme4 A T 17: 26,093,888 Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 R171* probably null Het
Olfr63 A G 17: 33,269,374 I217V probably benign Het
Osgep G T 14: 50,915,890 T326K probably damaging Het
Pdgfd C T 9: 6,337,271 T201M probably benign Het
Pdk4 T C 6: 5,487,086 D320G probably benign Het
Pelp1 A T 11: 70,394,726 V772D probably damaging Het
Pkdrej T A 15: 85,816,523 R1737S probably benign Het
Ppp1r13b A T 12: 111,834,886 Y578N probably damaging Het
Ppp1r3b A C 8: 35,384,175 K56T probably benign Het
Prdm11 G T 2: 92,989,283 H261N probably benign Het
Preb T A 5: 30,958,765 N166I probably benign Het
Psd3 T C 8: 67,882,982 K681R possibly damaging Het
Ptgs1 G A 2: 36,251,280 V580I probably damaging Het
Ptpro T A 6: 137,430,739 S949T probably benign Het
Pum2 A G 12: 8,748,802 E973G possibly damaging Het
Rdh1 A G 10: 127,760,023 D29G probably benign Het
Rel A G 11: 23,742,957 S359P probably benign Het
Rnf165 T C 18: 77,466,753 D248G possibly damaging Het
Ryr3 T A 2: 112,730,428 H2996L probably benign Het
Scarb1 C T 5: 125,294,039 C323Y probably damaging Het
Scn5a C T 9: 119,498,127 R1309H probably damaging Het
Serpinb12 T A 1: 106,953,739 V202E probably damaging Het
Shh A G 5: 28,458,300 L290P possibly damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc34a2 G A 5: 53,058,372 G42R probably benign Het
Slc41a1 A G 1: 131,830,823 N68D possibly damaging Het
Slc7a6os A G 8: 106,210,724 S64P probably damaging Het
Smc1b A G 15: 85,110,650 probably null Het
Snx9 T C 17: 5,918,476 V349A possibly damaging Het
Sstr1 G T 12: 58,213,527 G312V probably damaging Het
Tnfsf10 A G 3: 27,335,659 I290V probably benign Het
Trio A G 15: 27,805,684 C1717R possibly damaging Het
Ttbk1 T G 17: 46,446,568 S1047R probably damaging Het
Ttn T C 2: 76,916,533 D4724G probably benign Het
Uba1y T A Y: 825,542 N301K probably benign Het
Unc5c A G 3: 141,827,549 T853A probably benign Het
Wdr37 A T 13: 8,805,933 M458K probably damaging Het
Zdhhc14 A T 17: 5,712,454 Y211F probably benign Het
Zfp108 G A 7: 24,261,333 V450I probably benign Het
Zfp212 A T 6: 47,930,926 R280* probably null Het
Zfp940 A T 7: 29,835,617 V108E unknown Het
Other mutations in Vmn2r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn2r45 APN 7 8485623 missense probably benign 0.00
IGL01322:Vmn2r45 APN 7 8481333 missense possibly damaging 0.49
IGL01402:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01404:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01529:Vmn2r45 APN 7 8483494 missense probably benign
IGL01596:Vmn2r45 APN 7 8483273 missense probably damaging 0.98
IGL01646:Vmn2r45 APN 7 8483338 missense probably benign 0.18
IGL01819:Vmn2r45 APN 7 8485557 missense probably benign 0.00
IGL02096:Vmn2r45 APN 7 8481444 missense probably damaging 0.99
IGL02130:Vmn2r45 APN 7 8483557 missense possibly damaging 0.46
IGL02409:Vmn2r45 APN 7 8485728 missense probably benign 0.03
IGL02517:Vmn2r45 APN 7 8483186 nonsense probably null
IGL02633:Vmn2r45 APN 7 8485729 missense probably benign 0.01
IGL02940:Vmn2r45 APN 7 8472370 missense probably damaging 0.99
IGL03281:Vmn2r45 APN 7 8483604 missense probably damaging 1.00
IGL03358:Vmn2r45 APN 7 8471716 missense probably damaging 1.00
BB004:Vmn2r45 UTSW 7 8483514 missense probably benign
BB014:Vmn2r45 UTSW 7 8483514 missense probably benign
R0382:Vmn2r45 UTSW 7 8483099 missense probably benign 0.06
R0532:Vmn2r45 UTSW 7 8471821 missense probably damaging 0.99
R0932:Vmn2r45 UTSW 7 8475381 missense probably damaging 1.00
R1125:Vmn2r45 UTSW 7 8485543 missense probably benign 0.00
R1580:Vmn2r45 UTSW 7 8471747 missense possibly damaging 0.95
R1817:Vmn2r45 UTSW 7 8472373 missense probably damaging 1.00
R1996:Vmn2r45 UTSW 7 8472025 missense probably damaging 1.00
R2050:Vmn2r45 UTSW 7 8472022 missense probably damaging 1.00
R2284:Vmn2r45 UTSW 7 8485766 missense probably benign 0.02
R4019:Vmn2r45 UTSW 7 8471581 nonsense probably null
R4227:Vmn2r45 UTSW 7 8483278 missense probably damaging 0.98
R4381:Vmn2r45 UTSW 7 8471913 nonsense probably null
R4618:Vmn2r45 UTSW 7 8483437 missense probably benign 0.00
R4624:Vmn2r45 UTSW 7 8481342 missense probably damaging 1.00
R4704:Vmn2r45 UTSW 7 8483536 nonsense probably null
R4735:Vmn2r45 UTSW 7 8483473 missense probably damaging 1.00
R4868:Vmn2r45 UTSW 7 8481481 missense probably benign 0.06
R4983:Vmn2r45 UTSW 7 8483117 missense probably damaging 0.99
R5246:Vmn2r45 UTSW 7 8483252 missense probably benign 0.00
R5430:Vmn2r45 UTSW 7 8483334 nonsense probably null
R5504:Vmn2r45 UTSW 7 8483177 missense probably benign 0.03
R5511:Vmn2r45 UTSW 7 8471833 missense probably benign 0.19
R5745:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R5814:Vmn2r45 UTSW 7 8471476 missense probably benign 0.00
R6223:Vmn2r45 UTSW 7 8483302 missense probably benign
R6267:Vmn2r45 UTSW 7 8472208 missense probably benign 0.26
R6623:Vmn2r45 UTSW 7 8471501 missense probably benign 0.09
R6999:Vmn2r45 UTSW 7 8483220 missense probably benign
R7242:Vmn2r45 UTSW 7 8485613 nonsense probably null
R7491:Vmn2r45 UTSW 7 8481343 missense probably benign 0.27
R7620:Vmn2r45 UTSW 7 8483223 nonsense probably null
R7719:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7720:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7853:Vmn2r45 UTSW 7 8482988 missense possibly damaging 0.90
R7882:Vmn2r45 UTSW 7 8483410 missense possibly damaging 0.82
R7927:Vmn2r45 UTSW 7 8483514 missense probably benign
U24488:Vmn2r45 UTSW 7 8472362 missense probably damaging 1.00
Z1088:Vmn2r45 UTSW 7 8471485 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTTTAAGTCTGGTCATCTGAAAGAC -3'
(R):5'- CCCCACCATGGTGTGATTTCTG -3'

Sequencing Primer
(F):5'- GTCTGGTCATCTGAAAGACTCTAAAC -3'
(R):5'- GTACAGACATGGTTCCATCTCAG -3'
Posted On2019-12-20