Incidental Mutation 'R8032:Grid1'
ID618048
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8032 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35323359 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 386 (D386E)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably benign
Transcript: ENSMUST00000043349
AA Change: D386E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D386E

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,667,498 E60D probably benign Het
Adamts12 T C 15: 11,259,103 probably null Het
Ak9 T A 10: 41,424,620 C1609S unknown Het
Aox2 A T 1: 58,350,283 Y1147F probably benign Het
Atf7ip T C 6: 136,565,112 F615L probably benign Het
BC005624 A G 2: 30,975,889 probably null Het
BC024063 T A 10: 82,107,904 M33K probably benign Het
Bmpr2 T A 1: 59,867,343 S532T probably benign Het
Cast G A 13: 74,735,241 Q292* probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 TCAGGC TCAGGCACAGGC 7: 45,188,206 probably benign Het
Ccdc7a G T 8: 128,825,383 H1249N unknown Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Col15a1 T C 4: 47,288,108 I4T unknown Het
Cyp2c39 A G 19: 39,510,982 I38V probably benign Het
Dmpk A G 7: 19,088,053 D312G possibly damaging Het
Dnah1 T C 14: 31,271,548 D2892G probably damaging Het
Dnah10 G A 5: 124,746,612 D566N probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd2 T A 12: 80,489,653 D352E probably benign Het
Fgf8 A T 19: 45,737,237 L187Q probably damaging Het
Frrs1 A G 3: 116,878,360 I36V probably benign Het
Gga2 A T 7: 122,020,987 probably null Het
Gigyf2 C G 1: 87,407,013 H249D unknown Het
Gli2 A T 1: 118,836,170 M1417K probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm49380 A T 9: 44,111,703 I416N probably damaging Het
Gpr137 T C 19: 6,942,112 T16A unknown Het
Grm3 A G 5: 9,512,272 V526A probably benign Het
Havcr2 A T 11: 46,479,291 I231F probably damaging Het
Icam5 C A 9: 21,033,218 R72S probably benign Het
Ighv9-2 T A 12: 114,109,144 I70L possibly damaging Het
Inpp5e C T 2: 26,396,853 S119N Het
Kxd1 T A 8: 70,514,141 D110V possibly damaging Het
Mbd4 A G 6: 115,844,633 S474P probably damaging Het
Meaf6 C A 4: 125,103,002 H168Q unknown Het
Nek2 T C 1: 191,826,345 L254S probably damaging Het
Nhej1 T C 1: 74,968,800 D104G probably benign Het
Nmnat3 A G 9: 98,410,218 E172G probably benign Het
Npm3 A T 19: 45,748,243 D152E probably benign Het
Nsd1 A T 13: 55,310,383 K2103M probably damaging Het
Ntrk3 C T 7: 78,356,059 R518H probably damaging Het
Nup210 T A 6: 91,074,349 T351S probably benign Het
Olfr1013 A G 2: 85,769,866 I22V probably benign Het
Olfr1564 T A 17: 33,215,950 R131S possibly damaging Het
Otof T A 5: 30,461,798 M1L probably benign Het
Pacs2 T A 12: 113,061,658 Y477N probably damaging Het
Panx3 A G 9: 37,661,670 Y195H probably damaging Het
Pcsk5 T C 19: 17,714,787 R178G probably damaging Het
Pde7a A G 3: 19,260,265 S56P possibly damaging Het
Prcp T G 7: 92,928,698 C392G probably damaging Het
Prkdc A G 16: 15,779,451 K2825R probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rbl1 A T 2: 157,187,998 Y468* probably null Het
Rbmxl2 A G 7: 107,210,222 Y238C probably damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Slc25a18 G A 6: 120,792,491 G237D probably damaging Het
Slc9a3 G A 13: 74,157,644 G260D probably damaging Het
Sorcs1 A T 19: 50,475,408 S201R probably benign Het
Strip1 A C 3: 107,618,078 D547E probably damaging Het
Thsd7a C T 6: 12,555,288 C199Y Het
Top1mt A G 15: 75,668,723 V233A probably damaging Het
Tpp2 C G 1: 43,975,468 P656A possibly damaging Het
Ttc1 A T 11: 43,737,979 L193Q probably damaging Het
Ttll4 T A 1: 74,696,473 D1013E possibly damaging Het
Unc5a T C 13: 54,996,486 V208A possibly damaging Het
Vmn1r185 C A 7: 26,611,133 V316F probably benign Het
Vmn2r112 T A 17: 22,603,394 V351E probably benign Het
Wdfy4 T A 14: 33,029,086 K2391* probably null Het
Zfhx3 T C 8: 108,951,222 V2968A possibly damaging Het
Zfp551 G A 7: 12,418,560 A82V possibly damaging Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCTGATGTCCTGGGAC -3'
(R):5'- CATGATGGACTCAGGTTTGTGC -3'

Sequencing Primer
(F):5'- GATGTCCTGGGACTACTAATGACTC -3'
(R):5'- TGCTTGAAAGTTCTCTATGAGTCC -3'
Posted On2020-01-23