Incidental Mutation 'R6662:Ablim1'
ID528042
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
MMRRC Submission
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 57073853 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably null
Transcript: ENSMUST00000079360
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099294
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000104902
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111526
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111528
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111529
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111544
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111546
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111550
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111555
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111558
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111559
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
R7111:Ablim1 UTSW 19 57073877 missense probably benign 0.05
R7291:Ablim1 UTSW 19 57215908 missense probably benign
R7363:Ablim1 UTSW 19 57215741 missense probably benign 0.10
R7984:Ablim1 UTSW 19 57131002 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTACCTTAGGAGAGAGCTGGAAAG -3'
(R):5'- GAAATAGTCTCTGGTTGGCAGG -3'

Sequencing Primer
(F):5'- GCTCTTTGCTGCCCCAC -3'
(R):5'- TTGGCAGGTGTGTGTACC -3'
Posted On2018-07-24