Incidental Mutation 'R8181:Clca3b'
ID 634602
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8181 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144822623-144849357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144839137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 363 (N363S)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: N363S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: N363S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,068,395 S1115N probably damaging Het
9030617O03Rik A G 12: 100,850,111 probably null Het
Abca1 A G 4: 53,059,303 V1551A probably benign Het
Adam30 T C 3: 98,162,975 I708T probably benign Het
Aim1 T A 10: 43,986,326 Y1484F probably damaging Het
Aknad1 T A 3: 108,752,012 L114H possibly damaging Het
Akr1c18 G A 13: 4,135,263 S290L probably benign Het
Aldh18a1 G T 19: 40,557,437 D635E probably benign Het
Bax G T 7: 45,466,274 P23Q probably null Het
Bhlha15 A T 5: 144,191,426 N119Y probably damaging Het
Boll T A 1: 55,363,319 M1L probably benign Het
C2cd2 A T 16: 97,892,302 I123N probably benign Het
Cacnb4 A C 2: 52,474,985 S89A probably benign Het
Calca A G 7: 114,635,152 C21R probably benign Het
Calcr T C 6: 3,693,899 I325M probably benign Het
Card14 T A 11: 119,321,892 F94Y probably damaging Het
Chil3 A C 3: 106,149,887 I247S probably damaging Het
Cnksr3 A G 10: 7,120,475 V494A possibly damaging Het
Cog4 A G 8: 110,852,085 probably null Het
Dmp1 T A 5: 104,211,514 probably null Het
Dscaml1 T A 9: 45,746,842 I1637N possibly damaging Het
Ercc6 T A 14: 32,557,948 I640N probably damaging Het
Esp16 G T 17: 39,539,816 E29* probably null Het
Fam149a T C 8: 45,381,718 I15V possibly damaging Het
Flt4 T A 11: 49,634,896 I724N probably damaging Het
Glb1 C T 9: 114,430,361 R202C probably damaging Het
Gmpr2 C A 14: 55,672,984 S41* probably null Het
Golgb1 T A 16: 36,916,830 D2187E probably damaging Het
Gpsm2 A G 3: 108,689,764 probably null Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hemgn A C 4: 46,396,504 M244R possibly damaging Het
Hsd3b1 A T 3: 98,856,137 V56E probably damaging Het
Jup A T 11: 100,376,925 I524N probably damaging Het
Kdm1b G T 13: 47,051,901 probably null Het
Kif11 A T 19: 37,390,647 probably null Het
Lars A T 18: 42,228,770 W591R probably damaging Het
Lrtm1 T A 14: 29,021,937 S121T probably damaging Het
Med12l A C 3: 59,261,968 D1593A probably damaging Het
Med17 A T 9: 15,277,632 D112E possibly damaging Het
Mettl2 T A 11: 105,129,040 F168I probably benign Het
Mmp9 A T 2: 164,950,445 D323V probably damaging Het
Mpzl2 C T 9: 45,049,708 T214I probably benign Het
Ms4a15 T C 19: 10,981,306 H134R probably benign Het
Ms4a6d T A 19: 11,603,289 I2F probably damaging Het
Muc3a G A 5: 137,210,078 P206S unknown Het
Nectin2 C A 7: 19,724,808 L359F probably damaging Het
Olfr1276 T A 2: 111,257,573 F153I probably benign Het
Olfr1371 C A 11: 52,213,269 C240F probably damaging Het
Pgm1 G T 5: 64,112,124 C518F possibly damaging Het
Plppr4 A G 3: 117,322,465 V581A probably damaging Het
Prkra G C 2: 76,639,290 L142V probably damaging Het
Prpf38a G A 4: 108,576,998 T74I probably benign Het
Ptprs T A 17: 56,429,064 N635I probably damaging Het
Rxfp2 A G 5: 150,063,736 N361D probably benign Het
Ryr3 T G 2: 112,778,243 I2351L probably damaging Het
Sfmbt2 A T 2: 10,575,379 T618S probably benign Het
Six6 A G 12: 72,940,132 D26G probably damaging Het
Slc20a1 T C 2: 129,209,127 L568P probably damaging Het
Slx4ip T A 2: 137,000,184 C10S probably damaging Het
Sox13 G T 1: 133,383,760 T578K probably benign Het
Spire2 A T 8: 123,361,303 S509C probably damaging Het
Sptbn4 T C 7: 27,375,383 D1521G possibly damaging Het
Sult2a7 T C 7: 14,470,173 T207A probably benign Het
Sun2 A G 15: 79,725,520 I708T probably damaging Het
Supt5 T C 7: 28,331,474 E44G unknown Het
Thsd1 A G 8: 22,243,006 E23G probably damaging Het
Ticrr T C 7: 79,660,980 V214A possibly damaging Het
Vmn2r74 A T 7: 85,956,116 F441L probably damaging Het
Zfp30 A G 7: 29,793,655 T526A probably benign Het
Zfp518a G T 19: 40,913,971 Q781H probably damaging Het
Zmynd11 A G 13: 9,689,651 V434A probably benign Het
Zranb1 A G 7: 132,983,779 D652G probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8966:Clca3b UTSW 3 144839111 missense probably benign 0.27
R9003:Clca3b UTSW 3 144827311 nonsense probably null
R9455:Clca3b UTSW 3 144823262 missense unknown
R9470:Clca3b UTSW 3 144837695 missense probably damaging 1.00
R9658:Clca3b UTSW 3 144837814 missense probably damaging 0.98
R9760:Clca3b UTSW 3 144846849 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCCTTGGTGAGAGTTGAAG -3'
(R):5'- TAAAGATACTCCAGAGTTGCTCTC -3'

Sequencing Primer
(F):5'- CCTTGGTGAGAGTTGAAGAAGTCATC -3'
(R):5'- TCCAGAGTTGCTCTCATATATATGC -3'
Posted On 2020-07-13