Incidental Mutation 'R8181:Clca3b'
ID 634602
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 067605-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R8181 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144544898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 363 (N363S)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: N363S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: N363S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,774,156 (GRCm39) S1115N probably damaging Het
Abca1 A G 4: 53,059,303 (GRCm39) V1551A probably benign Het
Adam30 T C 3: 98,070,291 (GRCm39) I708T probably benign Het
Aknad1 T A 3: 108,659,328 (GRCm39) L114H possibly damaging Het
Akr1c18 G A 13: 4,185,262 (GRCm39) S290L probably benign Het
Aldh18a1 G T 19: 40,545,881 (GRCm39) D635E probably benign Het
Bax G T 7: 45,115,698 (GRCm39) P23Q probably null Het
Bhlha15 A T 5: 144,128,244 (GRCm39) N119Y probably damaging Het
Boll T A 1: 55,402,478 (GRCm39) M1L probably benign Het
C2cd2 A T 16: 97,693,502 (GRCm39) I123N probably benign Het
Cacnb4 A C 2: 52,364,997 (GRCm39) S89A probably benign Het
Calca A G 7: 114,234,387 (GRCm39) C21R probably benign Het
Calcr T C 6: 3,693,899 (GRCm39) I325M probably benign Het
Card14 T A 11: 119,212,718 (GRCm39) F94Y probably damaging Het
Chil3 A C 3: 106,057,203 (GRCm39) I247S probably damaging Het
Cnksr3 A G 10: 7,070,475 (GRCm39) V494A possibly damaging Het
Cog4 A G 8: 111,578,717 (GRCm39) probably null Het
Crybg1 T A 10: 43,862,322 (GRCm39) Y1484F probably damaging Het
Dglucy A G 12: 100,816,370 (GRCm39) probably null Het
Dmp1 T A 5: 104,359,380 (GRCm39) probably null Het
Dscaml1 T A 9: 45,658,140 (GRCm39) I1637N possibly damaging Het
Ercc6 T A 14: 32,279,905 (GRCm39) I640N probably damaging Het
Esp16 G T 17: 39,850,707 (GRCm39) E29* probably null Het
Fam149a T C 8: 45,834,755 (GRCm39) I15V possibly damaging Het
Flt4 T A 11: 49,525,723 (GRCm39) I724N probably damaging Het
Glb1 C T 9: 114,259,429 (GRCm39) R202C probably damaging Het
Gmpr2 C A 14: 55,910,441 (GRCm39) S41* probably null Het
Golgb1 T A 16: 36,737,192 (GRCm39) D2187E probably damaging Het
Gpsm2 A G 3: 108,597,080 (GRCm39) probably null Het
Helz A G 11: 107,563,399 (GRCm39) D1613G unknown Het
Hemgn A C 4: 46,396,504 (GRCm39) M244R possibly damaging Het
Hsd3b1 A T 3: 98,763,453 (GRCm39) V56E probably damaging Het
Jup A T 11: 100,267,751 (GRCm39) I524N probably damaging Het
Kdm1b G T 13: 47,205,377 (GRCm39) probably null Het
Kif11 A T 19: 37,379,095 (GRCm39) probably null Het
Lars1 A T 18: 42,361,835 (GRCm39) W591R probably damaging Het
Lrtm1 T A 14: 28,743,894 (GRCm39) S121T probably damaging Het
Med12l A C 3: 59,169,389 (GRCm39) D1593A probably damaging Het
Med17 A T 9: 15,188,928 (GRCm39) D112E possibly damaging Het
Mettl2 T A 11: 105,019,866 (GRCm39) F168I probably benign Het
Mmp9 A T 2: 164,792,365 (GRCm39) D323V probably damaging Het
Mpzl2 C T 9: 44,961,006 (GRCm39) T214I probably benign Het
Ms4a15 T C 19: 10,958,670 (GRCm39) H134R probably benign Het
Ms4a6d T A 19: 11,580,653 (GRCm39) I2F probably damaging Het
Muc3a G A 5: 137,244,535 (GRCm39) P206S unknown Het
Nectin2 C A 7: 19,458,733 (GRCm39) L359F probably damaging Het
Or2y6 C A 11: 52,104,096 (GRCm39) C240F probably damaging Het
Or4f53 T A 2: 111,087,918 (GRCm39) F153I probably benign Het
Pgm2 G T 5: 64,269,467 (GRCm39) C518F possibly damaging Het
Plppr4 A G 3: 117,116,114 (GRCm39) V581A probably damaging Het
Prkra G C 2: 76,469,634 (GRCm39) L142V probably damaging Het
Prpf38a G A 4: 108,434,195 (GRCm39) T74I probably benign Het
Ptprs T A 17: 56,736,064 (GRCm39) N635I probably damaging Het
Rxfp2 A G 5: 149,987,201 (GRCm39) N361D probably benign Het
Ryr3 T G 2: 112,608,588 (GRCm39) I2351L probably damaging Het
Sfmbt2 A T 2: 10,580,190 (GRCm39) T618S probably benign Het
Six6 A G 12: 72,986,906 (GRCm39) D26G probably damaging Het
Slc20a1 T C 2: 129,051,047 (GRCm39) L568P probably damaging Het
Slx4ip T A 2: 136,842,104 (GRCm39) C10S probably damaging Het
Sox13 G T 1: 133,311,498 (GRCm39) T578K probably benign Het
Spire2 A T 8: 124,088,042 (GRCm39) S509C probably damaging Het
Sptbn4 T C 7: 27,074,808 (GRCm39) D1521G possibly damaging Het
Sult2a7 T C 7: 14,204,098 (GRCm39) T207A probably benign Het
Sun2 A G 15: 79,609,721 (GRCm39) I708T probably damaging Het
Supt5 T C 7: 28,030,899 (GRCm39) E44G unknown Het
Thsd1 A G 8: 22,733,022 (GRCm39) E23G probably damaging Het
Ticrr T C 7: 79,310,728 (GRCm39) V214A possibly damaging Het
Vmn2r74 A T 7: 85,605,324 (GRCm39) F441L probably damaging Het
Zfp30 A G 7: 29,493,080 (GRCm39) T526A probably benign Het
Zfp518a G T 19: 40,902,415 (GRCm39) Q781H probably damaging Het
Zmynd11 A G 13: 9,739,687 (GRCm39) V434A probably benign Het
Zranb1 A G 7: 132,585,508 (GRCm39) D652G probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCCTTGGTGAGAGTTGAAG -3'
(R):5'- TAAAGATACTCCAGAGTTGCTCTC -3'

Sequencing Primer
(F):5'- CCTTGGTGAGAGTTGAAGAAGTCATC -3'
(R):5'- TCCAGAGTTGCTCTCATATATATGC -3'
Posted On 2020-07-13