Incidental Mutation 'R8201:Plpp3'
ID635667
Institutional Source Beutler Lab
Gene Symbol Plpp3
Ensembl Gene ENSMUSG00000028517
Gene Namephospholipid phosphatase 3
SynonymsLpp3, Ppap2b, D4Bwg1535e, 1110003O22Rik, D4Bwg0538e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location105157347-105232764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105219358 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 223 (G223W)
Ref Sequence ENSEMBL: ENSMUSP00000065719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064139]
Predicted Effect probably damaging
Transcript: ENSMUST00000064139
AA Change: G223W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065719
Gene: ENSMUSG00000028517
AA Change: G223W

DomainStartEndE-ValueType
low complexity region 86 101 N/A INTRINSIC
acidPPc 131 272 1.47e-57 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is a membrane glycoprotein localized at the cell plasma membrane. It has been shown to actively hydrolyze extracellular lysophosphatidic acid and short-chain phosphatidic acid. The expression of this gene is found to be enhanced by epidermal growth factor in Hela cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutant mice do not survive past E10.5 and show defects in extraembryonic vasculogenesis and axis patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Plpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02972:Plpp3 APN 4 105208792 missense possibly damaging 0.61
R1681:Plpp3 UTSW 4 105208805 critical splice donor site probably null
R4827:Plpp3 UTSW 4 105230970 missense probably benign 0.04
R5093:Plpp3 UTSW 4 105194880 missense probably damaging 0.99
R5869:Plpp3 UTSW 4 105194962 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCAGCATTTCCCCATGGG -3'
(R):5'- AACAGGCATCAGTTCAGGG -3'

Sequencing Primer
(F):5'- ATGGGGCATCGTGTCCG -3'
(R):5'- CTCTGTATGAGTGCCAAGGAC -3'
Posted On2020-07-13