Incidental Mutation 'R8201:Olfr18'
ID635678
Institutional Source Beutler Lab
Gene Symbol Olfr18
Ensembl Gene ENSMUSG00000066896
Gene Nameolfactory receptor 18
SynonymsGA_x6K02T2PVTD-14054886-14053957, MOR145-1, MTPCR34
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20312152-20336094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20314612 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 103 (M103V)
Ref Sequence ENSEMBL: ENSMUSP00000083664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086473]
Predicted Effect probably benign
Transcript: ENSMUST00000086473
AA Change: M103V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083664
Gene: ENSMUSG00000066896
AA Change: M103V

DomainStartEndE-ValueType
Pfam:7tm_4 53 330 1.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 57 234 3.2e-9 PFAM
Pfam:7tm_1 63 312 4.7e-25 PFAM
Meta Mutation Damage Score 0.2843 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Rcan3 A G 4: 135,420,373 F81S probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Olfr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Olfr18 APN 9 20314719 missense probably damaging 1.00
IGL02412:Olfr18 APN 9 20314639 missense probably benign
IGL03288:Olfr18 APN 9 20335911 critical splice donor site probably null
IGL03395:Olfr18 APN 9 20314551 missense probably damaging 1.00
R0332:Olfr18 UTSW 9 20314056 missense probably benign 0.00
R0346:Olfr18 UTSW 9 20314411 missense probably benign 0.20
R0569:Olfr18 UTSW 9 20314579 missense probably damaging 1.00
R0798:Olfr18 UTSW 9 20314199 nonsense probably null
R0865:Olfr18 UTSW 9 20314749 missense probably damaging 1.00
R1082:Olfr18 UTSW 9 20314469 missense possibly damaging 0.52
R1905:Olfr18 UTSW 9 20314846 missense probably benign
R4245:Olfr18 UTSW 9 20314333 missense possibly damaging 0.87
R5566:Olfr18 UTSW 9 20313969 missense probably benign
R6306:Olfr18 UTSW 9 20314446 missense probably benign 0.25
R6721:Olfr18 UTSW 9 20314280 missense probably benign 0.24
R6787:Olfr18 UTSW 9 20335925 missense probably benign
R6930:Olfr18 UTSW 9 20314099 missense probably damaging 1.00
R7196:Olfr18 UTSW 9 20314198 missense probably benign 0.38
R7711:Olfr18 UTSW 9 20314023 missense possibly damaging 0.66
R8023:Olfr18 UTSW 9 20314249 missense probably benign 0.00
R8029:Olfr18 UTSW 9 20314347 missense possibly damaging 0.59
R8050:Olfr18 UTSW 9 20314645 missense probably damaging 1.00
R8058:Olfr18 UTSW 9 20314180 missense probably damaging 0.99
R8159:Olfr18 UTSW 9 20314719 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCACAAAGACGAGGGTTC -3'
(R):5'- CGTATCTCAGAATTCCACCTCATG -3'

Sequencing Primer
(F):5'- TTCATAATGAACTGGTAGTGCAAAGG -3'
(R):5'- TCATGGGACTCTCAGATGACCTG -3'
Posted On2020-07-13