Incidental Mutation 'R8201:Rcan3'
ID635669
Institutional Source Beutler Lab
Gene Symbol Rcan3
Ensembl Gene ENSMUSG00000059713
Gene Nameregulator of calcineurin 3
SynonymsCsp3, Dscr1l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8201 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location135412308-135433853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135420373 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 81 (F81S)
Ref Sequence ENSEMBL: ENSMUSP00000030606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030606] [ENSMUST00000132654] [ENSMUST00000156635]
Predicted Effect probably damaging
Transcript: ENSMUST00000030606
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030606
Gene: ENSMUSG00000059713
AA Change: F81S

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Calcipressin 56 226 9e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132654
AA Change: F34S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114220
Gene: ENSMUSG00000059713
AA Change: F34S

DomainStartEndE-ValueType
Pfam:Calcipressin 9 135 1.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156635
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118447
Gene: ENSMUSG00000059713
AA Change: F81S

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Calcipressin 56 159 1.6e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,401,397 E543G probably benign Het
2210408I21Rik T A 13: 77,193,159 N302K possibly damaging Het
Apbb2 T C 5: 66,309,115 N609S probably benign Het
Atp10a G T 7: 58,819,676 G1092* probably null Het
Ccdc150 A G 1: 54,329,487 N618S probably benign Het
Cct4 T A 11: 22,999,115 V287E probably damaging Het
Cyp2j7 A T 4: 96,195,327 I462N probably damaging Het
Dnajc6 C T 4: 101,618,763 A611V probably benign Het
Dusp10 C A 1: 184,037,005 A56E possibly damaging Het
Fam189b T C 3: 89,185,808 V291A probably damaging Het
Fat3 A C 9: 15,997,477 C2410G possibly damaging Het
Fcgrt T A 7: 45,095,210 Q274L possibly damaging Het
Fdxacb1 G T 9: 50,770,155 probably benign Het
Fubp1 T A 3: 152,222,186 I424N probably damaging Het
Gm5114 T A 7: 39,410,949 T159S probably damaging Het
Gm7168 T C 17: 13,949,780 C470R probably benign Het
Hebp1 A G 6: 135,137,908 V185A possibly damaging Het
Il18rap G T 1: 40,539,269 R280I possibly damaging Het
Mamdc4 T C 2: 25,566,081 N771S probably damaging Het
Ndufaf4 A G 4: 24,898,197 N11D possibly damaging Het
Nkiras1 T C 14: 18,276,908 probably benign Het
Noct T C 3: 51,248,023 S135P probably benign Het
Olfr18 T C 9: 20,314,612 M103V probably benign Het
Olfr317 A C 11: 58,733,114 F17C probably damaging Het
Olfr330 A T 11: 58,529,039 *316R noncoding transcript Het
Olfr382 T A 11: 73,517,073 N42I probably damaging Het
Olfr873 G T 9: 20,301,021 G271C probably damaging Het
Pcdhac1 A T 18: 37,090,839 H235L probably benign Het
Pcdhb22 G T 18: 37,518,465 probably benign Het
Pdlim1 A T 19: 40,230,514 D224E probably benign Het
Plpp3 G T 4: 105,219,358 G223W probably damaging Het
Sel1l2 A C 2: 140,266,392 Y191D probably damaging Het
Supt16 A G 14: 52,170,990 F833L probably damaging Het
Tchh T C 3: 93,443,474 F74L probably damaging Het
Tgfbr3 T C 5: 107,130,565 D725G probably benign Het
Tmem14c C T 13: 41,017,710 P10S probably benign Het
Ubb G A 11: 62,552,227 A28T probably benign Het
Vars2 A T 17: 35,658,310 V833E probably benign Het
Zfyve9 T C 4: 108,650,277 D528G possibly damaging Het
Other mutations in Rcan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02574:Rcan3 APN 4 135425395 missense probably benign 0.05
R0016:Rcan3 UTSW 4 135418378 critical splice donor site probably null
R0412:Rcan3 UTSW 4 135416603 splice site probably null
R1531:Rcan3 UTSW 4 135425284 missense probably damaging 0.98
R1938:Rcan3 UTSW 4 135412501 splice site probably null
R2229:Rcan3 UTSW 4 135425377 missense probably benign 0.30
R5159:Rcan3 UTSW 4 135425281 missense probably damaging 0.99
R5973:Rcan3 UTSW 4 135418542 missense probably benign 0.00
R7070:Rcan3 UTSW 4 135416587 missense probably damaging 1.00
R7649:Rcan3 UTSW 4 135412488 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAAGAACAGAGGCTCAATGTGC -3'
(R):5'- ACTCTGAACACCAGTGAGAAAG -3'

Sequencing Primer
(F):5'- GTGACTGCTGACCTCACAGAC -3'
(R):5'- CCAGTGAGAAAGGAGCCGC -3'
Posted On2020-07-13