Incidental Mutation 'R7957:Mmp14'
List |< first << previous [record 21 of 52] next >> last >|
ID649911
Institutional Source Beutler Lab
Gene Symbol Mmp14
Ensembl Gene ENSMUSG00000000957
Gene Namematrix metallopeptidase 14 (membrane-inserted)
Synonymssabe, Membrane type 1-MMP, MT1-MMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R7957 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54431612-54445364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54436250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 124 (I124V)
Ref Sequence ENSEMBL: ENSMUSP00000087119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089688] [ENSMUST00000196155] [ENSMUST00000197874] [ENSMUST00000225641]
Predicted Effect probably benign
Transcript: ENSMUST00000089688
AA Change: I124V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000087119
Gene: ENSMUSG00000000957
AA Change: I124V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:PG_binding_1 36 88 2.1e-12 PFAM
ZnMc 115 285 6.01e-58 SMART
HX 323 366 3.97e-9 SMART
HX 368 412 1.42e-10 SMART
HX 415 461 4.45e-12 SMART
HX 463 508 1.61e-9 SMART
Pfam:DUF3377 512 582 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196155
Predicted Effect probably benign
Transcript: ENSMUST00000197874
Predicted Effect probably benign
Transcript: ENSMUST00000225641
AA Change: I124V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit craniofacial dysmorphism, arthritis, osteopenia, dwarfism, and fibrosis of soft tissues. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations may lead to postnatal or premature death, craniofacial anomalies, skeletal dysplasia, low body weight, reduced bone formation and chondrocyte proliferation, arthritis, and fibrosis as well as defects in angiogenesis and lung, tooth,kidney, and submaxillary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,091,613 M1T probably null Het
Abhd2 T A 7: 79,325,446 M128K probably benign Het
Adamts12 A G 15: 11,317,212 T1333A possibly damaging Het
Alg8 A G 7: 97,390,924 T438A probably benign Het
Cebpa A G 7: 35,120,442 I342V possibly damaging Het
Chd9 T C 8: 91,051,698 M2779T probably damaging Het
Cnot3 C A 7: 3,658,222 P577T probably benign Het
Col17a1 T C 19: 47,661,117 D755G probably damaging Het
Col5a3 A G 9: 20,774,051 V1443A unknown Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Fam193a A G 5: 34,462,086 D1031G probably damaging Het
Fam83b T A 9: 76,491,985 H612L probably benign Het
Gabrr2 A G 4: 33,081,410 T149A probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm3667 T C 14: 6,872,332 N156D probably benign Het
Hpcal1 T A 12: 17,791,170 L183Q probably damaging Het
Ilf2 G T 3: 90,487,470 E342* probably null Het
Ints13 A G 6: 146,550,766 S652P probably damaging Het
Kansl2 C A 15: 98,524,618 E356D probably benign Het
Klhl6 T C 16: 19,949,451 E448G probably null Het
Morc2b A T 17: 33,135,773 D1008E probably benign Het
Muc16 A C 9: 18,643,471 V3842G unknown Het
Myo9b A T 8: 71,354,761 I1614F probably benign Het
Nipa1 A T 7: 55,979,799 C189S probably damaging Het
Nov G T 15: 54,746,338 S78I possibly damaging Het
Ntn4 T C 10: 93,644,473 probably benign Het
Olfr1274-ps A T 2: 90,401,051 Y130F probably damaging Het
Olfr146 T G 9: 39,019,053 I163L probably benign Het
Olfr329-ps A G 11: 58,542,798 L239P probably damaging Het
Olfr358 A G 2: 37,004,960 I218T probably benign Het
Olfr399 A C 11: 74,054,156 L201R probably damaging Het
Pank1 T A 19: 34,813,696 H528L probably damaging Het
Pappa2 A T 1: 158,761,561 L1698* probably null Het
Park7 A G 4: 150,903,884 S85P probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Rapgef2 T C 3: 79,214,969 E30G probably benign Het
Rhbdf1 A G 11: 32,210,523 F676L probably damaging Het
Rsf1 GGC GGCCACGGCAGC 7: 97,579,906 probably benign Het
Scd4 G T 19: 44,341,248 M219I probably benign Het
Slfn5 T A 11: 82,956,787 I166N probably benign Het
Smim22 A T 16: 5,008,225 D85V probably damaging Het
Socs2 T C 10: 95,414,950 E7G probably benign Het
Thumpd2 T C 17: 81,026,728 E477G probably benign Het
Tlr12 C T 4: 128,616,690 G589D probably benign Het
Ttn A T 2: 76,764,855 I20317K probably damaging Het
Ttyh2 A G 11: 114,708,864 probably null Het
Ugt2a3 T A 5: 87,327,191 D398V probably damaging Het
Vmn2r88 A T 14: 51,413,132 M101L Het
Vmn2r93 A T 17: 18,325,692 R609* probably null Het
Zfp473 C T 7: 44,732,492 E806K probably damaging Het
Zfp93 T C 7: 24,275,574 L328P probably damaging Het
Other mutations in Mmp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Mmp14 APN 14 54435790 missense possibly damaging 0.60
IGL01937:Mmp14 APN 14 54437596 splice site probably benign
IGL02565:Mmp14 APN 14 54440557 missense probably benign 0.02
cartoon UTSW 14 54439999 missense probably damaging 0.96
mumping UTSW 14 54439412 missense probably damaging 1.00
IGL03134:Mmp14 UTSW 14 54439106 missense probably damaging 1.00
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0538:Mmp14 UTSW 14 54438709 missense possibly damaging 0.47
R0612:Mmp14 UTSW 14 54440434 missense probably damaging 1.00
R2352:Mmp14 UTSW 14 54440545 missense probably benign 0.30
R3700:Mmp14 UTSW 14 54431932 unclassified probably benign
R4289:Mmp14 UTSW 14 54436208 nonsense probably null
R4888:Mmp14 UTSW 14 54436205 missense probably damaging 0.98
R5068:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5069:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5070:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5216:Mmp14 UTSW 14 54437663 missense possibly damaging 0.82
R5607:Mmp14 UTSW 14 54439412 missense probably damaging 1.00
R6053:Mmp14 UTSW 14 54435890 missense probably benign 0.39
R6477:Mmp14 UTSW 14 54437658 missense probably damaging 1.00
R7153:Mmp14 UTSW 14 54436251 missense possibly damaging 0.93
R7212:Mmp14 UTSW 14 54435879 missense probably damaging 1.00
R7555:Mmp14 UTSW 14 54437742 missense possibly damaging 0.96
R8263:Mmp14 UTSW 14 54435787 missense probably damaging 1.00
R8409:Mmp14 UTSW 14 54440668 missense probably damaging 1.00
R8785:Mmp14 UTSW 14 54436775 missense probably damaging 1.00
RF003:Mmp14 UTSW 14 54439014 nonsense probably null
X0064:Mmp14 UTSW 14 54431946 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGGTCAACTACAGCACTACAC -3'
(R):5'- AGGCTTAGGGGATCTTCAGG -3'

Sequencing Primer
(F):5'- ACACTCTGTCCCTTTGAAGATGG -3'
(R):5'- CGAGAGTGTATGCTCTTCAAAATGGC -3'
Posted On2020-09-15