Incidental Mutation 'R8437:Abhd2'
ID654043
Institutional Source Beutler Lab
Gene Symbol Abhd2
Ensembl Gene ENSMUSG00000039202
Gene Nameabhydrolase domain containing 2
SynonymsLABH2, 2210009N18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79273199-79365508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79348430 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 237 (Y237H)
Ref Sequence ENSEMBL: ENSMUSP00000038361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037315]
Predicted Effect probably damaging
Transcript: ENSMUST00000037315
AA Change: Y237H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038361
Gene: ENSMUSG00000039202
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:Hydrolase_4 124 362 1.1e-10 PFAM
Pfam:Abhydrolase_1 126 383 2.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a wide range of enzymes. The encoded protein is an acylglycerol lipase that catalyzes the hydrolysis of endocannabinoid arachidonoylglycerol from the cell membrane. This leads to activation of the sperm calcium channel CatSper, which results in sperm activation. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele are overtly but exhibit enhanced migratory ability of cultured smooth muscle cells, and significant intimal hyperplasia after cuff placement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Abhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Abhd2 APN 7 79325452 missense possibly damaging 0.91
IGL03067:Abhd2 APN 7 79360034 missense probably benign
Redeemer UTSW 7 79354027 missense probably benign 0.02
R0363:Abhd2 UTSW 7 79350813 missense possibly damaging 0.81
R1587:Abhd2 UTSW 7 79354010 missense probably benign 0.01
R1921:Abhd2 UTSW 7 79348356 missense possibly damaging 0.83
R3108:Abhd2 UTSW 7 79323585 missense probably benign 0.01
R4374:Abhd2 UTSW 7 79323530 missense probably benign 0.00
R4621:Abhd2 UTSW 7 79325487 missense probably damaging 1.00
R4763:Abhd2 UTSW 7 79360131 missense probably benign 0.00
R5217:Abhd2 UTSW 7 79323630 missense probably benign
R5599:Abhd2 UTSW 7 79296998 splice site probably null
R6972:Abhd2 UTSW 7 79354027 missense probably benign 0.02
R7617:Abhd2 UTSW 7 79348284 missense probably benign 0.10
R7957:Abhd2 UTSW 7 79325446 missense probably benign 0.42
R8062:Abhd2 UTSW 7 79325590 missense possibly damaging 0.81
R8309:Abhd2 UTSW 7 79348347 missense probably damaging 1.00
R8424:Abhd2 UTSW 7 79297137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCACGTGGGAATTTG -3'
(R):5'- CAGGTGTAACAAGCCCTAGGAC -3'

Sequencing Primer
(F):5'- TTGGAGCCATGGTGAACTACATC -3'
(R):5'- CCCATTTGAGCCTAAGTGTTGGAAAC -3'
Posted On2020-10-20