Incidental Mutation 'R8735:Cyp17a1'
ID663019
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Namecytochrome P450, family 17, subfamily a, polypeptide 1
Synonymssteroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R8735 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46667165-46672974 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 46671094 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
Predicted Effect probably null
Transcript: ENSMUST00000026012
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C T 1: 93,154,486 probably null Het
6430550D23Rik A G 2: 156,003,811 F9S unknown Het
Abhd10 A G 16: 45,737,634 F101L probably damaging Het
Acp2 A G 2: 91,204,306 T93A probably benign Het
Adamts9 C T 6: 92,860,067 probably benign Het
Aknad1 T A 3: 108,775,299 probably benign Het
Ank3 A T 10: 69,986,955 T485S probably benign Het
Caly G A 7: 140,072,590 R82C probably damaging Het
Cfhr2 A G 1: 139,858,605 L8P probably damaging Het
Cpeb2 T A 5: 43,281,432 L869* probably null Het
Cxxc1 A G 18: 74,217,260 K33E possibly damaging Het
Cyp4a30b G A 4: 115,452,779 W59* probably null Het
Dennd4b T C 3: 90,277,865 V1204A probably damaging Het
Dpyd T A 3: 119,141,916 D663E possibly damaging Het
Esrrg A T 1: 188,201,008 probably benign Het
Exoc2 A C 13: 30,906,839 L261V probably damaging Het
Exosc9 T C 3: 36,555,513 L185S probably damaging Het
Gcnt3 T C 9: 70,034,446 K280R probably benign Het
Gm35339 T C 15: 76,356,575 Y488H Het
Ighv1-64 A T 12: 115,507,597 M100K probably benign Het
Impdh2 G A 9: 108,564,779 probably null Het
Itsn2 T A 12: 4,671,474 I1068K probably damaging Het
Kif5c T C 2: 49,694,771 C169R probably damaging Het
Kndc1 A G 7: 139,910,214 S211G probably benign Het
Lama2 T A 10: 27,190,534 E1117V probably damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lsg1 T A 16: 30,581,047 probably null Het
Msh3 A G 13: 92,274,866 S608P possibly damaging Het
Mslnl T A 17: 25,745,088 F464I probably benign Het
Mycbp2 T A 14: 103,223,150 K1493N probably damaging Het
Myo15 A T 11: 60,510,853 probably null Het
Myo1b A T 1: 51,755,737 F1065I probably benign Het
Nf1 A G 11: 79,454,310 probably benign Het
Nup153 C A 13: 46,727,551 probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr1447 A G 19: 12,900,910 V290A possibly damaging Het
Osbpl7 A G 11: 97,052,368 T149A probably benign Het
Parp1 A G 1: 180,569,125 D31G probably benign Het
Pcdha6 T A 18: 36,968,150 V132E possibly damaging Het
Pcdhb8 T A 18: 37,356,922 L551Q possibly damaging Het
Pcsk9 T A 4: 106,454,611 T190S probably damaging Het
Pdgfrb A T 18: 61,063,977 T162S probably benign Het
Pi4ka C T 16: 17,318,370 R908Q Het
Pnpla8 A G 12: 44,283,439 E258G probably benign Het
Prrc2c A T 1: 162,709,558 S643T unknown Het
Rnf20 T G 4: 49,655,964 I970S possibly damaging Het
Robo2 A T 16: 73,958,359 V758D probably damaging Het
Robo4 G A 9: 37,408,281 S609N possibly damaging Het
Rrbp1 G A 2: 143,989,000 Q416* probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Ryr2 C A 13: 11,686,947 E2941D probably damaging Het
Scd2 G T 19: 44,301,304 C246F probably benign Het
Sh3rf1 G A 8: 61,372,653 V561I probably benign Het
Slc4a4 T A 5: 89,132,442 D366E probably damaging Het
Slfn14 T G 11: 83,283,889 Q92P probably damaging Het
Slfn4 A T 11: 83,186,944 Y186F probably damaging Het
Smpd4 T C 16: 17,635,546 L309P possibly damaging Het
Smyd3 G T 1: 179,092,917 N217K probably benign Het
Spen T C 4: 141,469,818 T3547A probably benign Het
Suclg1 A T 6: 73,276,746 I126F unknown Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmprss15 A T 16: 79,001,814 I660N possibly damaging Het
Trf A T 9: 103,210,524 V677D probably damaging Het
Trim36 T C 18: 46,169,385 N532S probably benign Het
Trim37 T C 11: 87,147,059 probably null Het
Ttn T C 2: 76,740,110 N26813S probably benign Het
Vmn1r199 T A 13: 22,383,367 V277D probably damaging Het
Wdfy3 T C 5: 101,930,085 D873G probably benign Het
Wdr27 T C 17: 14,883,667 T726A probably damaging Het
Wdtc1 A T 4: 133,304,200 C236* probably null Het
Wnk4 A C 11: 101,276,266 S1083R unknown Het
Wwc1 A T 11: 35,883,407 I342N probably damaging Het
Zbtb40 A G 4: 136,998,646 L534P probably damaging Het
Zfp62 T C 11: 49,217,400 C773R probably damaging Het
Zfp709 T A 8: 71,889,183 I152N probably benign Het
Zfp738 T C 13: 67,671,431 Y147C probably damaging Het
Zscan18 A C 7: 12,769,698 S645A probably benign Het
Zw10 A G 9: 49,077,561 Y709C probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
R8737:Cyp17a1 UTSW 19 46669727 missense probably benign 0.09
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTAAGAAATGGCTGCACCC -3'
(R):5'- CAAATCCAGGGTTCTTTCTGTC -3'

Sequencing Primer
(F):5'- AGCCGCCCAGCATCCTTC -3'
(R):5'- AAATCCAGGGTTCTTTCTGTCTCCTC -3'
Posted On2021-03-08