Incidental Mutation 'R8888:Dock5'
ID 677514
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R8888 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67817663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 585 (Y585H)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect possibly damaging
Transcript: ENSMUST00000039135
AA Change: Y585H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: Y585H

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Ankrd12 T C 17: 66,031,573 probably null Het
Atp8b5 A G 4: 43,304,687 N66S Het
Bean1 CT C 8: 104,182,032 probably null Het
Birc6 G A 17: 74,528,538 S24N probably null Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Capn12 T A 7: 28,886,524 probably benign Het
Cdh1 T A 8: 106,604,339 F34Y probably damaging Het
Cdh5 T C 8: 104,125,460 I69T possibly damaging Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Clasp2 T A 9: 113,903,868 M924K possibly damaging Het
Col3a1 G A 1: 45,339,979 A850T unknown Het
Cped1 C T 6: 22,016,963 P104S possibly damaging Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dopey1 A G 9: 86,521,534 I132V probably benign Het
Dpysl5 C T 5: 30,745,343 R40C probably benign Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Epg5 C A 18: 78,012,871 D1753E possibly damaging Het
Ext1 T C 15: 53,092,327 Y458C probably damaging Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Frmd6 C A 12: 70,893,872 H430Q possibly damaging Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Htr2a C T 14: 74,645,177 T201I possibly damaging Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Klhl29 A T 12: 5,137,542 L274H possibly damaging Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Nek5 C T 8: 22,090,479 probably null Het
Nlrc5 G A 8: 94,525,490 V1880I probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr1318 G A 2: 112,156,629 R226H probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Pccb A T 9: 101,023,252 probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Pik3c2g A T 6: 139,730,366 K79* probably null Het
Pou3f1 C G 4: 124,658,359 A218G possibly damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rad52 C T 6: 119,913,080 R56C probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spdye4a T G 5: 143,225,663 S49R probably benign Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Syt14 A G 1: 192,897,558 S473P probably damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Usp2 G T 9: 44,075,597 R64L probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCTGGTCTGGTATAAGGAGTC -3'
(R):5'- CCATGATAAAGTTACTTCTGCTGC -3'

Sequencing Primer
(F):5'- CCTGGTCTGGTATAAGGAGTCTAAAC -3'
(R):5'- CCTGAGAGATATTGCCCT -3'
Posted On 2021-08-02