Incidental Mutation 'R8936:Dock5'
ID 680673
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R8936 (G1)
Quality Score 211.009
Status Not validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 67845990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 157 (R157*)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably null
Transcript: ENSMUST00000039135
AA Change: R157*
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: R157*

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G A 14: 49,770,567 T483I probably damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abcc2 A G 19: 43,808,662 K491E probably benign Het
Abcd3 T C 3: 121,775,468 I374V probably benign Het
Adam34 G A 8: 43,651,402 T402I probably benign Het
Angptl7 G T 4: 148,497,333 H199N probably benign Het
Ankrd11 A G 8: 122,895,101 C671R possibly damaging Het
Anxa7 G A 14: 20,471,427 P67L unknown Het
Ap3d1 T A 10: 80,712,118 Q913H probably benign Het
Arhgef37 A G 18: 61,523,877 I39T probably damaging Het
BC049762 A G 11: 51,254,422 S113P probably damaging Het
C3ar1 T A 6: 122,851,085 T58S probably damaging Het
Caap1 A T 4: 94,501,095 L334Q probably damaging Het
Ccr1 A T 9: 123,963,845 I216K probably damaging Het
Cdh9 T A 15: 16,831,076 probably null Het
Cept1 A G 3: 106,504,605 F351S possibly damaging Het
Cfap61 A G 2: 145,949,959 D112G possibly damaging Het
Cul9 T A 17: 46,528,602 S817C possibly damaging Het
Dido1 A G 2: 180,661,402 S1570P probably benign Het
Disc1 A G 8: 125,088,015 D206G probably damaging Het
Dpp6 A G 5: 27,721,142 D738G probably damaging Het
Enpep A G 3: 129,332,235 F83L possibly damaging Het
F10 G T 8: 13,045,086 W81L probably damaging Het
Fam129c T A 8: 71,607,663 probably benign Het
Fam217a T C 13: 34,911,164 D356G probably damaging Het
Fes T C 7: 80,381,725 E467G probably damaging Het
Fignl2 A T 15: 101,053,458 D314E unknown Het
Foxh1 T C 15: 76,668,519 probably benign Het
Gdpd5 T C 7: 99,459,992 L573P probably benign Het
Gigyf1 T A 5: 137,525,207 S934T probably damaging Het
Gm7356 C T 17: 14,001,675 V31I probably benign Het
Hoxa2 C A 6: 52,163,537 K156N probably damaging Het
Ifi203 G A 1: 173,929,291 probably benign Het
Il5ra A T 6: 106,715,643 D380E possibly damaging Het
Ino80c C A 18: 24,121,808 probably benign Het
Kif18a T A 2: 109,333,621 W772R probably benign Het
Lipo3 G T 19: 33,580,480 Q171K probably damaging Het
Mga A T 2: 119,964,228 T2798S probably damaging Het
Mybpc1 T A 10: 88,558,575 T297S probably benign Het
Myh7 T G 14: 54,990,983 Q222P probably benign Het
N4bp2l2 T C 5: 150,661,897 D206G probably benign Het
Nacc2 G C 2: 26,062,204 T380S probably benign Het
Nkpd1 T A 7: 19,521,950 D186E probably damaging Het
Nol10 A T 12: 17,416,862 E581V probably benign Het
Ntrk1 A T 3: 87,786,059 N255K possibly damaging Het
Nudt5 T G 2: 5,864,417 D151E probably benign Het
Obscn A T 11: 59,002,032 L6796Q probably benign Het
Olfr730 A G 14: 50,186,542 I225T possibly damaging Het
Olfr763 C T 10: 129,011,933 A216V probably benign Het
Oxct2b A G 4: 123,117,045 T253A probably benign Het
Patl1 G A 19: 11,914,361 C10Y probably damaging Het
Pikfyve A G 1: 65,271,268 R1905G possibly damaging Het
Pkhd1l1 A G 15: 44,538,916 E2228G possibly damaging Het
Plcg1 A G 2: 160,748,066 K135E probably benign Het
Proz A G 8: 13,065,319 T112A probably benign Het
Prune2 A G 19: 17,121,835 N1568D probably benign Het
Rbm4 A G 19: 4,787,511 V431A probably benign Het
Rgs19 G T 2: 181,691,265 C40* probably null Het
Rimbp3 T A 16: 17,213,020 I1436K probably benign Het
Rnps1 T A 17: 24,422,202 M192K probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Slc17a9 G A 2: 180,738,417 V318I probably benign Het
Slc5a12 A G 2: 110,637,110 I412V probably damaging Het
Smc4 T A 3: 69,018,158 N329K probably benign Het
St3gal4 G A 9: 35,053,427 R165W probably damaging Het
Strbp G A 2: 37,603,937 R375* probably null Het
Tacc2 A G 7: 130,626,637 N1684S possibly damaging Het
Tet1 A T 10: 62,840,284 L671* probably null Het
Tex2 C A 11: 106,567,318 E429* probably null Het
Tgm4 T C 9: 123,040,476 I40T possibly damaging Het
Tmem132d C T 5: 127,792,612 D553N probably damaging Het
Tnks A T 8: 34,853,347 Y723* probably null Het
Tnks1bp1 A T 2: 85,063,976 T1416S probably benign Het
Tnxb T A 17: 34,685,672 L1137Q probably damaging Het
Tor4a A C 2: 25,195,190 C68G probably damaging Het
Tubb2b A C 13: 34,128,462 V116G probably damaging Het
Upb1 T A 10: 75,414,993 S99T probably benign Het
Vmn1r31 T A 6: 58,472,098 I261F unknown Het
Vmn1r53 T C 6: 90,223,589 Y251C probably benign Het
Vmn2r58 T C 7: 41,864,557 R221G Het
Vmn2r88 A T 14: 51,418,526 I740F possibly damaging Het
Zfp644 C T 5: 106,635,637 G1015R probably damaging Het
Zfy1 T C Y: 738,726 D160G unknown Het
Zscan25 T A 5: 145,286,390 V156E probably damaging Het
Zyg11b A T 4: 108,252,159 F443I Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCCCAAGAGTCACTGATACA -3'
(R):5'- GTGAAGATAGATGCCTTCTCTTCA -3'

Sequencing Primer
(F):5'- CTGTAAAGTCCTGGGATCAGAGCTC -3'
(R):5'- GATAGATGCCTTCTCTTCATTGCATC -3'
Posted On 2021-08-31