Incidental Mutation 'R5159:Dock5'
ID396898
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67792289 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1019 (R1019C)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: R1019C

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: R1019C

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Meta Mutation Damage Score 0.3851 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCTTCCGTGTTTGACAATG -3'
(R):5'- ATTCAAGTGTACACTGCCTGCC -3'

Sequencing Primer
(F):5'- GATAGGATCTGAAATGGCCCTTTCTC -3'
(R):5'- CTCTTCCAGACCTTGAGAGAAAGTG -3'
Posted On2016-06-21