Mutagenetix > Incidental Mutation

Incidental Mutation 'R9423:Adamts19'

712462

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9423 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 58890355 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 274 (R274L)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052907
AA Change: R274L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R274L

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.1992

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (23/23)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
2700081O15Rik	T	C	19: 7,420,259	L57P	probably damaging	Het
4932415D10Rik	C	A	10: 82,287,625	V3184L	possibly damaging	Het
Aatk	A	G	11: 120,010,694	S959P	probably damaging	Het
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Abcb10	A	G	8: 123,962,080	S486P		Het
Ahcyl1	C	T	3: 107,671,160	E254K	probably damaging	Het
Ccdc177	T	G	12: 80,757,388	D704A	unknown	Het
Cd200r3	T	C	16: 44,951,532	V53A	probably benign	Het
Cdc42bpg	T	C	19: 6,313,299	L429P	probably damaging	Het
Cdh23	T	C	10: 60,312,608	D2660G	probably damaging	Het
Cfap61	G	T	2: 146,143,235	A1000S	probably damaging	Het
Col28a1	T	C	6: 7,999,601	T1039A	probably benign	Het
Ctsd	A	G	7: 142,385,475	L71P	probably damaging	Het
Dab2ip	C	T	2: 35,709,954	T251M	probably damaging	Het
Dcaf8	T	A	1: 172,179,957	I331N	probably damaging	Het
Dcp2	C	T	18: 44,405,294	R173C	probably damaging	Het
Dgka	C	T	10: 128,721,186	C640Y	probably damaging	Het
Fam189b	T	A	3: 89,184,700	L155Q	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Htr2a	T	A	14: 74,706,076	F365L	probably damaging	Het
Kdm5b	T	C	1: 134,587,967	Y110H	possibly damaging	Het
Ktn1	A	G	14: 47,674,861	T362A	probably benign	Het
Ltbp1	G	A	17: 75,290,117	S581N	probably benign	Het
Nr1h4	C	A	10: 89,473,826	R347L	possibly damaging	Het
Olfr1313	A	T	2: 112,072,463	M40K	possibly damaging	Het
Olfr943	G	T	9: 39,184,542	M118I	probably damaging	Het
Parg	T	G	14: 32,217,705	F563V	probably damaging	Het
Pfkfb3	T	C	2: 11,482,465	Y378C	probably damaging	Het
Pitpnm2	A	C	5: 124,133,406	L368R	probably benign	Het
Pkd1l3	A	G	8: 109,623,680	T386A	possibly damaging	Het
Plch2	C	A	4: 154,986,592	C1110F		Het
Poc5	T	C	13: 96,410,606	V459A	probably damaging	Het
Pou4f3	T	C	18: 42,395,894	S301P	probably damaging	Het
Rpf2	T	C	10: 40,225,340	D233G	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Samd4b	A	G	7: 28,414,208	Y111H	probably benign	Het
Serpinb10	C	T	1: 107,538,449	T55M	probably benign	Het
Serpinb1a	C	T	13: 32,842,927	C344Y	probably benign	Het
Shprh	T	C	10: 11,205,263	V1524A	probably damaging	Het
Sirt1	T	C	10: 63,322,246	H463R	probably damaging	Het
Skor2	T	A	18: 76,860,605	L674Q	probably damaging	Het
Slc3a2	T	A	19: 8,712,825	K201M	possibly damaging	Het
Stam	C	A	2: 14,141,753	Q421K	possibly damaging	Het
Steap4	G	A	5: 7,976,720	V228M	probably damaging	Het
Tacr3	A	G	3: 134,932,282	Y400C	probably benign	Het
Tecpr1	A	G	5: 144,218,578	V54A	probably damaging	Het
Tgm3	A	T	2: 130,038,607	E444D	probably benign	Het
Trim30a	A	T	7: 104,429,203	L222Q	probably damaging	Het
Trmt1l	T	C	1: 151,450,066	Y421H	possibly damaging	Het
Usp24	T	C	4: 106,431,670	F2500L	probably damaging	Het
Vmn2r54	T	A	7: 12,615,514	S714C	probably damaging	Het
Washc5	A	G	15: 59,355,886	I409T	probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGCAAAGAGTTCGTGTGCAC -3'
(R):5'- TCCTGTGCTGGCCTTTGAAG -3'

Sequencing Primer
(F):5'- CAAAGAGTTCGTGTGCACATTCG -3'
(R):5'- TGCTGGCCTTTGAAGAATTTTAG -3'

Posted On

2022-05-16