Mutagenetix > Incidental Mutation

Incidental Mutation 'R3730:Adamts19'

270954

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3730 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58900910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 319 (R319Q)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: R319Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R319Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.2%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	G	1: 11,545,226	N141S	probably damaging	Het
Acbd6	T	A	1: 155,558,725	S30T	probably benign	Het
Acot12	T	A	13: 91,760,026	F109Y	possibly damaging	Het
Akap1	T	C	11: 88,845,182	E218G	possibly damaging	Het
Atg4b	T	A	1: 93,768,275	D45E	probably damaging	Het
Atoh1	A	G	6: 64,729,573	E84G	probably benign	Het
Cfap54	A	T	10: 93,011,473	Y951*	probably null	Het
Col4a4	T	A	1: 82,455,751		probably null	Het
Crlf1	A	G	8: 70,499,442	T95A	probably benign	Het
Cyp3a25	G	A	5: 146,003,081	P39S	probably damaging	Het
Dhx9	C	A	1: 153,478,120	A186S	probably benign	Het
Dusp16	A	G	6: 134,718,861	S336P	probably benign	Het
Fcgbp	T	C	7: 28,085,457	V314A	possibly damaging	Het
Focad	T	C	4: 88,408,925	I157T	possibly damaging	Het
Frem3	A	T	8: 80,615,916	T1613S	probably damaging	Het
Fshr	C	T	17: 89,001,715	V222I	probably benign	Het
Galnt13	A	G	2: 54,933,507	N365S	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ice1	A	T	13: 70,603,240	S1576T	probably damaging	Het
Ighv1-19	C	A	12: 114,708,877	C40F	probably damaging	Het
Itga8	T	C	2: 12,193,510	T555A	possibly damaging	Het
Kctd5	T	C	17: 24,059,238	D146G	probably benign	Het
Ktn1	A	G	14: 47,701,149	E766G	probably damaging	Het
Ldlr	C	G	9: 21,731,801	A41G	probably benign	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrp2	A	T	2: 69,534,907		probably null	Het
Mapk11	G	A	15: 89,145,115	A248V	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Npr2	T	C	4: 43,640,999	S402P	possibly damaging	Het
Olfm2	T	C	9: 20,672,767	N76D	probably damaging	Het
Olfr1047	A	G	2: 86,228,851	I40T	probably benign	Het
Olfr853	T	A	9: 19,537,151	I260F	probably benign	Het
Pias4	A	T	10: 81,164,054	F55Y	probably damaging	Het
Rgs12	G	A	5: 35,032,251	E658K	probably damaging	Het
Ripor3	C	G	2: 167,992,819	E251Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc35e4	A	G	11: 3,912,577	V204A	possibly damaging	Het
Syt4	T	C	18: 31,444,136	H55R	probably damaging	Het
Tmem2	A	G	19: 21,826,117	Y838C	probably damaging	Het
Trim46	T	A	3: 89,234,949	T721S	probably benign	Het
Usf3	G	T	16: 44,218,575	L1139F	probably benign	Het
Wdr66	A	T	5: 123,326,568	I1280L	possibly damaging	Het
Xrn2	A	T	2: 147,024,809	M100L	probably benign	Het
Zbtb33	C	A	X: 38,192,945	N243K	probably benign	Het
Zfp960	T	A	17: 17,088,371	L449H	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GATACATCTGATCAGTAGTCCACAGC -3'
(R):5'- GCCCCATGTTCAATGTCCAAC -3'

Sequencing Primer
(F):5'- AGCCCTCTGAGATACCATCTTGTAG -3'
(R):5'- CCATGTTCAATGTCCAACGTTAC -3'

Posted On

2015-03-18