Mutagenetix > Incidental Mutation

Incidental Mutation 'R7060:Adamts19'

548229

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

045157-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7060 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 58837640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 99 (R99*)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably null
Transcript: ENSMUST00000052907
AA Change: R99*

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R99*

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

96% (78/81)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610044O15Rik8	A	C	8: 129,219,132	I404R	probably benign	Het
5730559C18Rik	T	C	1: 136,220,197	K339R	possibly damaging	Het
Abcg4	T	A	9: 44,275,128	T535S	probably benign	Het
Alg6	C	T	4: 99,761,961	L473F	possibly damaging	Het
Ankar	A	T	1: 72,656,113	N893K	probably benign	Het
Ankrd54	G	A	15: 79,055,539	A183V	possibly damaging	Het
Anpep	G	T	7: 79,841,794	T153K	probably benign	Het
Arap1	A	G	7: 101,409,357		probably null	Het
Aspg	A	T	12: 112,122,953	T392S	probably benign	Het
B230307C23Rik	A	C	16: 98,010,131	R68S	probably benign	Het
Bdp1	G	C	13: 100,059,494	N1253K	probably damaging	Het
Ccrl2	G	A	9: 111,055,614	S272F	probably damaging	Het
Cdon	T	C	9: 35,486,909	L974P	probably damaging	Het
Celsr1	C	A	15: 86,032,655	E372D	probably benign	Het
Cers1	A	T	8: 70,315,905	M16L	possibly damaging	Het
Col2a1	G	T	15: 97,976,141	Q1387K	unknown	Het
Ddx39b	G	A	17: 35,252,750	V291M	probably damaging	Het
Dppa2	T	A	16: 48,315,713	S143T	probably benign	Het
Dpy19l1	A	T	9: 24,423,123	M583K	possibly damaging	Het
Eno3	A	T	11: 70,661,419	D299V	possibly damaging	Het
Epha8	C	T	4: 136,931,158	V969M	probably damaging	Het
Fcgbp	A	T	7: 28,091,933	H873L	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Fntb	A	C	12: 76,887,875	N173T	possibly damaging	Het
Gins2	T	A	8: 120,582,141	M125L	probably benign	Het
Gys1	G	A	7: 45,440,013	A199T	probably damaging	Het
Herpud1	C	A	8: 94,390,763	H116N	probably benign	Het
Hoga1	C	A	19: 42,060,246	Y134*	probably null	Het
Il10ra	A	G	9: 45,256,224	I343T	probably benign	Het
Inpp5j	C	T	11: 3,500,133		probably null	Het
Itpkb	T	C	1: 180,333,130	S274P	probably damaging	Het
Kalrn	C	T	16: 34,357,048	C249Y	probably damaging	Het
Klhl35	G	C	7: 99,468,458	A70P	possibly damaging	Het
Lhx1	A	G	11: 84,520,282		probably null	Het
Lmbrd1	T	C	1: 24,692,966	V88A	probably benign	Het
Macc1	T	G	12: 119,447,455	L653V	probably damaging	Het
Madd	T	C	2: 91,177,107	D220G	probably damaging	Het
Mllt10	T	A	2: 18,159,560	H300Q	possibly damaging	Het
Mlxipl	G	A	5: 135,132,315	A363T	possibly damaging	Het
Mus81	G	T	19: 5,487,793	D78E	probably benign	Het
Mxd1	A	T	6: 86,653,159	L26M	probably damaging	Het
Nhsl1	C	T	10: 18,526,503	T1159M	probably damaging	Het
Nos1ap	A	G	1: 170,338,125	S190P	possibly damaging	Het
Nwd1	A	C	8: 72,666,694	D195A	probably damaging	Het
Olfr103	G	T	17: 37,336,461	T257N	probably benign	Het
Olfr1058	T	A	2: 86,386,225	R64S	possibly damaging	Het
Olfr424	A	T	1: 174,136,810	D22V	probably benign	Het
Olfr892-ps1	G	A	9: 38,190,096	V124I	probably damaging	Het
Otof	T	C	5: 30,388,356	D500G	possibly damaging	Het
Pcgf5	T	A	19: 36,442,939	Y190*	probably null	Het
Pdcd11	C	T	19: 47,110,979	T839I	probably benign	Het
Ppard	G	C	17: 28,298,912	S318T	probably benign	Het
Ppfia2	A	G	10: 106,762,109	K178E	probably damaging	Het
Ppm1n	G	T	7: 19,279,262	R255S	probably damaging	Het
Ppp1r21	A	G	17: 88,580,544	Y693C	probably damaging	Het
Ppp2r5d	A	T	17: 46,687,353	V169E	possibly damaging	Het
Prc1	A	T	7: 80,304,373	T53S	probably benign	Het
Pwp2	A	C	10: 78,173,250		probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Ring1	A	G	17: 34,023,390	C48R	probably damaging	Het
Rpap1	T	C	2: 119,773,562	D496G	probably damaging	Het
Rspo4	C	A	2: 151,873,078	Q212K	unknown	Het
Samd9l	T	A	6: 3,372,716	D1515V	probably damaging	Het
Serinc3	T	C	2: 163,636,959	T83A	probably benign	Het
Setd5	A	C	6: 113,117,382	D420A	probably damaging	Het
Sidt2	T	C	9: 45,953,246	T62A	possibly damaging	Het
Smarcal1	T	C	1: 72,612,942	V621A	probably damaging	Het
Srcin1	A	G	11: 97,573,885	L12P	probably damaging	Het
Stx18	G	A	5: 38,121,255	D165N	possibly damaging	Het
Sumf2	A	G	5: 129,854,500	K139E	possibly damaging	Het
Tdo2	A	T	3: 81,969,559	I102N	probably damaging	Het
Tdp1	T	A	12: 99,911,688	S410T	probably benign	Het
Tmem94	A	T	11: 115,792,938	I726F	probably damaging	Het
Ttc21a	A	G	9: 119,966,676	E1192G	probably damaging	Het
Ttc8	T	C	12: 98,943,467	I52T	probably benign	Het
Vmn2r99	A	T	17: 19,394,564	R849*	probably null	Het
Wwc1	T	C	11: 35,915,176	K77E	possibly damaging	Het
Xirp2	A	T	2: 67,515,608	E2731V	probably damaging	Het
Zfp423	G	A	8: 87,782,879	T258I	probably damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GAAGTCGTGTTTCCTGCACTCTG -3'
(R):5'- TCCCGGTGTAAAAGCAGGAG -3'

Sequencing Primer
(F):5'- TCCTGCACTCTGGCGCC -3'
(R):5'- ACCTGGTTTGGGCCACTG -3'

Posted On

2019-05-13