Mutagenetix > Incidental Mutation

Incidental Mutation 'R6088:Adamts19'

486121

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

044245-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6088 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 58902102 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 360 (V360F)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: V360F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: V360F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	C	T	5: 90,253,688	E1605K	possibly damaging	Het
Arid4a	A	G	12: 71,022,236	D54G	probably damaging	Het
Baz2a	TCTCCTC	TCTC	10: 128,114,642		probably benign	Het
Card6	A	T	15: 5,105,019	V234E	possibly damaging	Het
Cd1d1	G	T	3: 86,998,702	Q89K	probably benign	Het
Ciita	G	A	16: 10,511,931	R693K	probably damaging	Het
Cox7a2l	G	T	17: 83,503,972	L77I	probably benign	Het
Crybg2	A	T	4: 134,075,790		probably null	Het
Cts8	T	C	13: 61,253,966	N39S	probably benign	Het
Def8	G	T	8: 123,460,048	E456*	probably null	Het
Dld	A	G	12: 31,340,989	F153L	probably benign	Het
Elf1	C	T	14: 79,567,261	T122I	probably benign	Het
Emilin2	T	C	17: 71,255,124	N961S	probably benign	Het
Esp24	A	G	17: 39,040,010	I34V	probably benign	Het
Fam129b	T	C	2: 32,923,123	V540A	probably damaging	Het
Fam184b	C	A	5: 45,584,012	K292N	probably damaging	Het
Gabrg3	T	A	7: 56,985,078	N119I	probably damaging	Het
Gucy1b1	T	C	3: 82,034,880	H524R	probably damaging	Het
Kcp	A	T	6: 29,502,632	S205T	probably benign	Het
Klb	C	T	5: 65,349,013	T201M	probably benign	Het
Lamp3	A	T	16: 19,673,398	F365L	probably damaging	Het
Mad1l1	T	A	5: 140,193,963	H390L	probably benign	Het
Mlxipl	T	C	5: 135,134,030	Y711H	possibly damaging	Het
Myo5b	T	A	18: 74,720,898	L1196Q	possibly damaging	Het
Ndufb8	A	G	19: 44,555,025	S70P	probably benign	Het
Neb	T	C	2: 52,209,342	D4832G	probably damaging	Het
Nr5a1	T	C	2: 38,701,995	D322G	probably benign	Het
Olfr396-ps1	A	T	11: 73,928,823	T273S	probably benign	Het
Olfr988	T	A	2: 85,353,354	S191C	probably damaging	Het
Oscar	G	A	7: 3,611,312	P143S	probably benign	Het
Oxa1l	T	A	14: 54,367,694		probably null	Het
Pafah2	A	G	4: 134,413,381	I221V	probably benign	Het
Pibf1	T	A	14: 99,179,358	F456I	probably benign	Het
Pla2g4d	C	T	2: 120,270,006	G615D	probably damaging	Het
Plekhg2	C	T	7: 28,361,013	V964I	probably benign	Het
Ppip5k1	C	A	2: 121,337,463	V770L	probably benign	Het
Ppl	A	T	16: 5,104,988	L213Q	possibly damaging	Het
Ptprf	G	A	4: 118,210,755	T1785I	possibly damaging	Het
Pycr2	G	A	1: 180,906,236	G131E	probably damaging	Het
Rbpj	C	T	5: 53,651,368		probably null	Het
Rcc1	G	T	4: 132,332,842	D430E	probably benign	Het
Rhbdf1	A	G	11: 32,212,007	V525A	possibly damaging	Het
Samd7	G	A	3: 30,756,483	M216I	probably benign	Het
Ska3	A	T	14: 57,816,694	D266E	probably benign	Het
Slc1a7	G	A	4: 108,012,444	V569M	probably damaging	Het
Slc26a1	C	T	5: 108,674,006	E6K	possibly damaging	Het
Slc4a4	T	A	5: 89,197,704	V741E	probably benign	Het
St6galnac3	C	T	3: 153,206,715	G164S	probably damaging	Het
Tgs1	T	A	4: 3,595,383	N517K	probably benign	Het
Tns4	A	G	11: 99,073,720	S522P	probably damaging	Het
Trpm1	A	T	7: 64,267,976	M355L	probably damaging	Het
Trpm8	G	A	1: 88,306,678		probably benign	Het
Uhrf1bp1	G	A	17: 27,884,605		probably null	Het
V1ra8	T	C	6: 90,203,100	F95S	probably damaging	Het
Zfp521	A	C	18: 13,846,109	S416A	possibly damaging	Het
Zfp574	T	A	7: 25,080,339	V262E	probably benign	Het
Zfp740	T	A	15: 102,208,808	I77N	probably damaging	Het
Zscan18	A	T	7: 12,775,198		probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ATCGCTGTACAAAGGATCTGTAG -3'
(R):5'- CCAAAGCAAGGGTCAGTTTTATG -3'

Sequencing Primer
(F):5'- AGAAATTTGATTTTGCTGCCTTCACC -3'
(R):5'- AAGCAAGGGTCAGTTTTATGTATAC -3'

Posted On

2017-08-16