Incidental Mutation 'R9423:Shprh'
ID 712441
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9423 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11205263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1524 (V1524A)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: V1524A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: V1524A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: V1524A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: V1524A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: V1524A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: V1524A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (23/23)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,694 (GRCm38) S959P probably damaging Het
Abca13 T C 11: 9,290,395 (GRCm38) S753P probably damaging Het
Abcb10 A G 8: 123,962,080 (GRCm38) S486P Het
Adamts19 G T 18: 58,890,355 (GRCm38) R274L possibly damaging Het
Ahcyl1 C T 3: 107,671,160 (GRCm38) E254K probably damaging Het
Ccdc177 T G 12: 80,757,388 (GRCm38) D704A unknown Het
Cd200r3 T C 16: 44,951,532 (GRCm38) V53A probably benign Het
Cdc42bpg T C 19: 6,313,299 (GRCm38) L429P probably damaging Het
Cdh23 T C 10: 60,312,608 (GRCm38) D2660G probably damaging Het
Cfap61 G T 2: 146,143,235 (GRCm38) A1000S probably damaging Het
Col28a1 T C 6: 7,999,601 (GRCm38) T1039A probably benign Het
Ctsd A G 7: 142,385,475 (GRCm38) L71P probably damaging Het
Dab2ip C T 2: 35,709,954 (GRCm38) T251M probably damaging Het
Dcaf8 T A 1: 172,179,957 (GRCm38) I331N probably damaging Het
Dcp2 C T 18: 44,405,294 (GRCm38) R173C probably damaging Het
Dgka C T 10: 128,721,186 (GRCm38) C640Y probably damaging Het
Entrep3 T A 3: 89,184,700 (GRCm38) L155Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 (GRCm38) probably null Het
Gpr141 T C 13: 19,751,825 (GRCm38) N260S probably benign Het
Htr2a T A 14: 74,706,076 (GRCm38) F365L probably damaging Het
Kdm5b T C 1: 134,587,967 (GRCm38) Y110H possibly damaging Het
Ktn1 A G 14: 47,674,861 (GRCm38) T362A probably benign Het
Ltbp1 G A 17: 75,290,117 (GRCm38) S581N probably benign Het
Nr1h4 C A 10: 89,473,826 (GRCm38) R347L possibly damaging Het
Or4f60 A T 2: 112,072,463 (GRCm38) M40K possibly damaging Het
Or8g26 G T 9: 39,184,542 (GRCm38) M118I probably damaging Het
Parg T G 14: 32,217,705 (GRCm38) F563V probably damaging Het
Pfkfb3 T C 2: 11,482,465 (GRCm38) Y378C probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 (GRCm38) probably benign Het
Pitpnm2 A C 5: 124,133,406 (GRCm38) L368R probably benign Het
Pkd1l3 A G 8: 109,623,680 (GRCm38) T386A possibly damaging Het
Plch2 C A 4: 154,986,592 (GRCm38) C1110F Het
Poc5 T C 13: 96,410,606 (GRCm38) V459A probably damaging Het
Pou4f3 T C 18: 42,395,894 (GRCm38) S301P probably damaging Het
Rpf2 T C 10: 40,225,340 (GRCm38) D233G possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 (GRCm38) probably benign Het
Samd4b A G 7: 28,414,208 (GRCm38) Y111H probably benign Het
Serpinb10 C T 1: 107,538,449 (GRCm38) T55M probably benign Het
Serpinb1a C T 13: 32,842,927 (GRCm38) C344Y probably benign Het
Sirt1 T C 10: 63,322,246 (GRCm38) H463R probably damaging Het
Skor2 T A 18: 76,860,605 (GRCm38) L674Q probably damaging Het
Slc3a2 T A 19: 8,712,825 (GRCm38) K201M possibly damaging Het
Spata31h1 C A 10: 82,287,625 (GRCm38) V3184L possibly damaging Het
Stam C A 2: 14,141,753 (GRCm38) Q421K possibly damaging Het
Steap4 G A 5: 7,976,720 (GRCm38) V228M probably damaging Het
Tacr3 A G 3: 134,932,282 (GRCm38) Y400C probably benign Het
Tecpr1 A G 5: 144,218,578 (GRCm38) V54A probably damaging Het
Tgm3 A T 2: 130,038,607 (GRCm38) E444D probably benign Het
Trim30a A T 7: 104,429,203 (GRCm38) L222Q probably damaging Het
Trmt1l T C 1: 151,450,066 (GRCm38) Y421H possibly damaging Het
Usp24 T C 4: 106,431,670 (GRCm38) F2500L probably damaging Het
Vmn2r54 T A 7: 12,615,514 (GRCm38) S714C probably damaging Het
Washc5 A G 15: 59,355,886 (GRCm38) I409T probably benign Het
Zfta T C 19: 7,420,259 (GRCm38) L57P probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,188,158 (GRCm38) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,188,020 (GRCm38) missense probably benign 0.37
IGL00684:Shprh APN 10 11,163,037 (GRCm38) missense probably benign 0.11
IGL01295:Shprh APN 10 11,183,868 (GRCm38) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,170,254 (GRCm38) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,170,019 (GRCm38) nonsense probably null
IGL01833:Shprh APN 10 11,191,062 (GRCm38) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,181,502 (GRCm38) splice site probably benign
IGL02502:Shprh APN 10 11,194,357 (GRCm38) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,154,765 (GRCm38) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,192,494 (GRCm38) frame shift probably null
R0010:Shprh UTSW 10 11,151,931 (GRCm38) missense probably benign
R0010:Shprh UTSW 10 11,151,931 (GRCm38) missense probably benign
R0053:Shprh UTSW 10 11,194,372 (GRCm38) splice site probably null
R0053:Shprh UTSW 10 11,194,372 (GRCm38) splice site probably null
R0255:Shprh UTSW 10 11,186,391 (GRCm38) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,170,109 (GRCm38) missense probably benign 0.00
R0331:Shprh UTSW 10 11,194,170 (GRCm38) splice site probably benign
R0494:Shprh UTSW 10 11,157,191 (GRCm38) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,162,812 (GRCm38) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,183,887 (GRCm38) splice site probably benign
R0574:Shprh UTSW 10 11,163,077 (GRCm38) unclassified probably benign
R0605:Shprh UTSW 10 11,207,112 (GRCm38) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,186,847 (GRCm38) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,213,482 (GRCm38) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,213,482 (GRCm38) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,159,530 (GRCm38) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,164,744 (GRCm38) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,157,078 (GRCm38) missense probably benign
R1830:Shprh UTSW 10 11,186,911 (GRCm38) splice site probably null
R1898:Shprh UTSW 10 11,186,869 (GRCm38) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,183,797 (GRCm38) nonsense probably null
R2060:Shprh UTSW 10 11,152,120 (GRCm38) missense probably benign 0.03
R2225:Shprh UTSW 10 11,162,235 (GRCm38) unclassified probably benign
R2363:Shprh UTSW 10 11,171,953 (GRCm38) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,166,724 (GRCm38) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,164,356 (GRCm38) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,170,413 (GRCm38) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,170,030 (GRCm38) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,178,757 (GRCm38) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,207,860 (GRCm38) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,186,518 (GRCm38) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,160,471 (GRCm38) missense probably benign 0.17
R4748:Shprh UTSW 10 11,170,476 (GRCm38) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,181,540 (GRCm38) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,164,557 (GRCm38) missense probably benign 0.00
R4937:Shprh UTSW 10 11,157,119 (GRCm38) missense probably benign
R5140:Shprh UTSW 10 11,154,705 (GRCm38) missense probably benign 0.03
R5318:Shprh UTSW 10 11,166,557 (GRCm38) missense probably benign 0.04
R5323:Shprh UTSW 10 11,170,297 (GRCm38) splice site probably null
R5450:Shprh UTSW 10 11,212,330 (GRCm38) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,188,073 (GRCm38) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,151,991 (GRCm38) missense probably benign 0.37
R6030:Shprh UTSW 10 11,151,991 (GRCm38) missense probably benign 0.37
R6392:Shprh UTSW 10 11,178,741 (GRCm38) nonsense probably null
R6416:Shprh UTSW 10 11,167,873 (GRCm38) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,171,937 (GRCm38) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,186,893 (GRCm38) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,194,267 (GRCm38) missense probably benign 0.02
R6678:Shprh UTSW 10 11,166,545 (GRCm38) missense probably benign 0.16
R6757:Shprh UTSW 10 11,181,508 (GRCm38) splice site probably null
R6971:Shprh UTSW 10 11,166,693 (GRCm38) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,166,730 (GRCm38) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,164,705 (GRCm38) missense probably benign
R7757:Shprh UTSW 10 11,162,180 (GRCm38) missense probably benign 0.30
R7812:Shprh UTSW 10 11,151,991 (GRCm38) missense probably benign
R7998:Shprh UTSW 10 11,185,341 (GRCm38) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,212,333 (GRCm38) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,151,811 (GRCm38) missense probably benign 0.22
R8116:Shprh UTSW 10 11,213,461 (GRCm38) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,187,983 (GRCm38) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,181,569 (GRCm38) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,151,934 (GRCm38) missense probably benign 0.37
R8759:Shprh UTSW 10 11,157,164 (GRCm38) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,185,437 (GRCm38) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,164,830 (GRCm38) nonsense probably null
R9053:Shprh UTSW 10 11,154,702 (GRCm38) missense probably benign 0.04
R9131:Shprh UTSW 10 11,162,845 (GRCm38) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,160,576 (GRCm38) missense probably benign 0.02
R9391:Shprh UTSW 10 11,162,889 (GRCm38) missense probably benign 0.05
R9563:Shprh UTSW 10 11,166,491 (GRCm38) nonsense probably null
R9668:Shprh UTSW 10 11,206,332 (GRCm38) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,162,830 (GRCm38) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,213,504 (GRCm38) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,164,460 (GRCm38) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,164,841 (GRCm38) missense probably benign 0.02
V8831:Shprh UTSW 10 11,186,862 (GRCm38) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,186,447 (GRCm38) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,164,553 (GRCm38) missense probably benign
Z1177:Shprh UTSW 10 11,151,762 (GRCm38) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTTGGTGATAAACTCATTCATTTCTG -3'
(R):5'- AGGCCATTTCATTTATGAACGAATC -3'

Sequencing Primer
(F):5'- CTCATTCATTTCTGCAATTAGACAC -3'
(R):5'- CGAGTCTTAGCTCTACTTCA -3'
Posted On 2022-05-16