Incidental Mutation 'R9526:Polr3a'
ID 719271
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC1, 9330175N20Rik, RPC155
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9526 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 24448696-24487058 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24453245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1174 (C1174S)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably benign
Transcript: ENSMUST00000026322
AA Change: C1174S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: C1174S

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,609,098 Y372C probably damaging Het
4930412O13Rik A T 2: 9,882,823 T12S unknown Het
Actn1 A G 12: 80,183,619 L287S probably damaging Het
Adgrf1 A T 17: 43,305,346 Q292L possibly damaging Het
Arhgap32 A G 9: 32,260,730 D1602G probably benign Het
Atrnl1 C T 19: 57,629,119 P109S probably damaging Het
Camsap1 G A 2: 25,953,950 H230Y probably benign Het
Capns1 C T 7: 30,192,187 C144Y probably damaging Het
Ccdc17 G A 4: 116,598,797 V341I possibly damaging Het
Cd36 T C 5: 17,797,035 T323A probably damaging Het
Cdc14a CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG 3: 116,293,860 probably benign Het
Ckap2l G A 2: 129,269,241 Q679* probably null Het
Clec4g T A 8: 3,718,565 N93I probably benign Het
Cntnap2 T A 6: 46,015,231 L364Q probably damaging Het
Cul9 A G 17: 46,530,100 M748T probably benign Het
Dnah11 A T 12: 118,186,976 I349N probably damaging Het
Dnajc14 T A 10: 128,806,391 Y61N probably benign Het
Dock6 A T 9: 21,802,506 Y1909* probably null Het
Dock8 T A 19: 25,188,375 D1874E probably benign Het
Dpm1 A G 2: 168,230,290 S22P probably benign Het
Dysf T C 6: 84,151,903 L1385P probably damaging Het
Egf T C 3: 129,697,772 T859A probably benign Het
Eif2b1 A T 5: 124,573,804 S162T probably benign Het
Emilin1 T C 5: 30,918,140 L575P probably damaging Het
Erp27 T A 6: 136,909,552 Q161L probably benign Het
Fbxw10 C A 11: 62,875,119 D738E possibly damaging Het
Fcgbp T G 7: 28,091,512 C733G probably damaging Het
Fgb T A 3: 83,049,815 probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Got1l1 G T 8: 27,198,475 Q283K probably benign Het
Grk2 G A 19: 4,290,843 R226C probably damaging Het
Hoxa10 T C 6: 52,234,354 D194G probably benign Het
Ipcef1 G A 10: 6,890,620 T363I probably damaging Het
Itga10 C A 3: 96,656,957 T922N probably damaging Het
Itgad T C 7: 128,178,380 I144T probably benign Het
Kat6b C A 14: 21,517,496 Q208K possibly damaging Het
Kidins220 T G 12: 25,038,384 L1042R probably damaging Het
Kmt2c T C 5: 25,281,357 S4733G probably damaging Het
Lrig3 A G 10: 126,014,867 I1101V probably benign Het
Lrp1 T A 10: 127,595,360 N311I probably damaging Het
Man2a1 A T 17: 64,651,315 K275I probably benign Het
Map3k10 T A 7: 27,665,009 N318I probably damaging Het
Map3k8 G A 18: 4,333,869 R408W probably damaging Het
Mast1 A G 8: 84,921,176 M523T probably damaging Het
Mast4 T C 13: 102,737,085 H1925R probably benign Het
Med12l C T 3: 59,076,786 S461L probably damaging Het
Mfap1a T C 2: 121,502,756 K65E probably damaging Het
Mical1 T C 10: 41,482,606 S507P probably benign Het
Miga2 T C 2: 30,378,388 V433A unknown Het
Mpdz T C 4: 81,356,416 T848A probably benign Het
Mycn A G 12: 12,939,777 V206A probably benign Het
Ndst1 G A 18: 60,705,148 Q342* probably null Het
Nectin1 A G 9: 43,791,072 M39V probably benign Het
Nectin4 A T 1: 171,382,641 R234* probably null Het
Ngb C G 12: 87,098,543 V113L possibly damaging Het
Nphp3 T A 9: 104,036,138 Y990N probably damaging Het
Nrd1 T C 4: 109,058,636 probably null Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr484 T A 7: 108,124,594 Y223F probably benign Het
Olfr714 A T 7: 107,074,532 K235* probably null Het
Osbpl6 A G 2: 76,585,259 Y655C probably damaging Het
Pcdhgb4 A G 18: 37,722,829 Q759R probably benign Het
Pcsk4 T C 10: 80,325,966 D164G probably damaging Het
Pde4d T A 13: 109,935,381 I303N probably damaging Het
Pdf T A 8: 107,048,340 M87L probably benign Het
Pigb A G 9: 73,034,558 S140P probably damaging Het
Plch1 T A 3: 63,851,128 probably benign Het
Plxna1 G T 6: 89,342,651 D557E probably benign Het
Polr2e C T 10: 80,036,958 V149M probably benign Het
Psmd2 T A 16: 20,655,619 S308R probably benign Het
Ptger1 T A 8: 83,669,373 V353E probably damaging Het
Ptprc A G 1: 138,068,373 M940T probably benign Het
Pus7l T C 15: 94,527,900 N540S probably damaging Het
Rap1gds1 T A 3: 139,050,556 I13L probably benign Het
Rasl10b A T 11: 83,412,764 N49I probably damaging Het
Rftn1 A T 17: 49,994,209 N537K probably benign Het
Rnase4 A G 14: 51,105,188 Y123C probably damaging Het
Rnf181 A C 6: 72,361,319 N26K probably benign Het
Rnf31 G A 14: 55,598,812 probably null Het
Rpusd3 C G 6: 113,416,239 C304S unknown Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 C A 2: 112,833,925 V1694L probably benign Het
Sephs2 T C 7: 127,273,174 D249G probably damaging Het
Serpina10 A G 12: 103,616,958 I409T probably damaging Het
Serpina5 C T 12: 104,103,144 A205V probably damaging Het
Sfr1 T A 19: 47,735,014 V319E probably damaging Het
Skil T A 3: 31,117,490 Y542N probably benign Het
Slc15a5 T C 6: 138,072,956 T154A probably benign Het
Slc27a2 T A 2: 126,587,926 L618Q probably damaging Het
Slc6a6 A T 6: 91,749,827 Y483F probably benign Het
Sprr1b T C 3: 92,437,136 I144M probably benign Het
Stat5a T A 11: 100,880,335 V580E Het
Tnk1 C T 11: 69,855,185 D305N probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Trav12-2 A G 14: 53,616,628 N20D probably benign Het
Trav16 T A 14: 53,743,589 N78K probably damaging Het
Trf C T 9: 103,226,931 A78T probably damaging Het
Ttn A G 2: 76,881,199 probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Vmn2r94 A T 17: 18,256,999 F383L probably benign Het
Vwa2 T C 19: 56,906,776 S461P probably benign Het
Zfp991 G A 4: 147,179,870 G568E probably damaging Het
Zfpl1 A G 19: 6,084,410 F15S probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
R8753:Polr3a UTSW 14 24463634 nonsense probably null
R8785:Polr3a UTSW 14 24452315 missense probably benign 0.06
R8848:Polr3a UTSW 14 24450766 missense probably damaging 1.00
R9025:Polr3a UTSW 14 24469411 missense probably damaging 1.00
R9139:Polr3a UTSW 14 24469348 missense probably damaging 1.00
R9264:Polr3a UTSW 14 24470831 missense probably benign
R9309:Polr3a UTSW 14 24459999 missense probably benign
R9363:Polr3a UTSW 14 24450763 missense probably damaging 1.00
R9585:Polr3a UTSW 14 24452221 missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTAGGGATATGACCACGAGGG -3'
(R):5'- GTAACTTCTGTGGCAGAGGAG -3'

Sequencing Primer
(F):5'- AGGGAGTGGGGTGCCATC -3'
(R):5'- AGACTTCTTAAAGCATCCTCATGTC -3'
Posted On 2022-07-18